Аденоиды мкб 10: Ошибка 404. Файл не найден

Содержание

Хронические болезни миндалин и аденоидов у детей > Клинические протоколы МЗ РК


ДИАГНОСТИКА НА АМБУЛАТОРНОМ УРОВНЕ

Диагностические критерии:

Жалобы и анамнез

Хронический тонзиллит:
·               частые ангины;
·               простудные заболевания;
·               боль в горле;
·               неприятные ощущения в глотке;
·               боль в мышцах, суставах;
·               слабость, вялость, быстрая утомляемость;
·               субфебрильная температура.

Гипертрофия небных миндалин:
·               затруднение дыхания, глотания;
·               затруднение речи;
·               храп ночью;
·               частые простудные заболевания;
·               рефлекторный кашель.

Гипертрофия аденоидов:  
·               заложенность носа;
·               затруднение носового дыхания, глотания;
·               постоянные насморки;
·               гнусавость;

·                храп ночью;
·               обструктивная остановка дыхания во сне;
·               частые простудные заболевания;
·               быстрая утомляемость;
·               частые отиты;
·               снижение слуха;
·               энурез.
 
Физикальное обследование:

Хронический тонзиллит
Локальный статус: жидкий гной или казеозно-гнойные пробки в лакунах, разрыхленная поверхность миндалин, признак Гизе – застойная гиперемия краев небно-язычных дужек, признак Зака – отечность верхних краев передних небных дужек, признак Преображенского – валикообразное утолщение краев небно-язычных дужек, сращения и спайки миндалин с дужками и треугольной складкой.
Общие признаки: субфебрильная температура (периодическая), тонзилогенная интоксикация, периодические боли в суставах, шейный лимфаденит, функциональные нарушения острого и хронического характера почек, сердца, сосудистой системы, суставов, печени и других органов, и систем.

Гипертрофия небных миндалин
Локальный статус: увеличение небных миндалин различной степени.
Общие признаки: нарушение дыхания во время сна, расстройство речи, головная боль, нарушение сна, быстрая утомляемость.

Гипертрофия аденоидов 
Локальный статус: увеличение аденоидных вегетаций различной степени.
Общие признаки: нарушение носового дыхания, гнусавость, нарушение роста лицевого черепа, расстройство слуха и речи, головная боль, нарушение сна, рассеянность, забывчивость, ночное недержание мочи.
 
Лабораторные исследования: не специфичны.
 
Инструментальные исследования:
·               Фарингоскопия;
·               Передняя риноскопия;

·               Задняя риноскопия;
·               Зондирование носоглотки;
·               Пальцевое исследование носоглотки;
 
Диагностический алгоритм

Аденоиды храп ночью — Отоларингология — Здоровье Mail.ru

Оглавление

  • Причины храпа у ребенка
  • Диагностика храпа
  • Лечение и профилактика храпа ребенка в зависимости от диагноза
  • Лечение храпа у детей современными народными средствами
  • Преимущества лечения храпа у детей в МЕДСИ

Храп — процесс, который часто сопровождает дыхание в виде низких вибрирующих звуков. Его основная причина — колебание мягких частей нёба, расположенных над корнем языка. Расслабляясь во сне, эти части могут опускаться, попадая в поток вдыхаемого и выдыхаемого воздуха, и вибрировать. Храп довольно часто встречается не только у взрослых, но и у детей, поэтому может долго не привлекать внимания. Однако не все причины храпа одинаково безобидны, и сам процесс может вызывать опасные осложнения, особенно у маленьких детей: это ночное апноэ (короткая остановка дыхания во сне) и гипоксия — недостаточное снабжение кислородом органов и тканей.

Причины храпа у ребенка

  • Аденоиды — разрастание железистой ткани глоточной миндалины — очень частое нарушение, возникающее в результате повторяющихся инфекций носоглотки; подавляющее большинство случаев храпа детей вызвано аденоидами
  • Риниты и синуситы — воспаления слизистых оболочек носа и придаточных носовых пазух, вызванные инфекциями или аллергией
  • Полипоз носа — образование полипов в полостях носа
  • Острые и хронические тонзиллиты, ангины, фарингиты и ларингиты — то есть воспалительные процессы в носоглотке и гортани
  • Бронхиальная астма
  • Анатомические особенности строения носовой, решетчатой или некоторых других костей черепа, включая искривление носовой перегородки и дефект нёба типа «волчья пасть»
  • Избыточный вес, при котором, помимо жирового слоя, разрастаются и ткани мягкого нёба, затрудняя дыхание
  • Увеличение щитовидной или вилочковой желез, которые начинают давить на окружающие ткани и органы
  • Узость дыхательных путей вследствие их незрелости или врожденного дефекта

Механизм возникновения храпа во многих случаях схож: мягкие ткани верхних дыхательных путей (носоглотки, гортани) увеличиваются в результате воспаления (отека) или гиперплазии (разрастания) и препятствуют свободному дыханию. Лечение храпа ребенка будет направлено на устранение причин патологии.

Диагностика храпа

Несмотря на кажущуюся очевидность, для диагностики храпа требуется дополнительное обследование, которое поможет установить его причину и подобрать схему лечения. Как правило, такими проблемами занимаются детские отоларингологи (ЛОР-врачи). ЛОР может рекомендовать:

  • Лучевую диагностику (рентген носа и пазух)
  • Томографию (послойный снимок органов носоглотки)
  • Эндоскопию (оптическое исследование носа, позволяет одновременно находить и удалять полипы, брать материал на анализ)
  • Мазок из носа и зева на микрофлору
  • Клинический анализ крови

Отоларинголог также может посоветовать консультацию у специалиста другого профиля (аллерголога, иммунолога, пульмонолога, эндокринолога или хирурга), если причина патологии вне его компетенции.

Если причина храпа кроется в анатомических особенностях или последствиях травмы, чтобы установить необходимость хирургического вмешательства, ребенку могут назначить полисомнографию — исследование дыхания во сне. Цель этого метода — зафиксировать апноэ (краткую остановку дыхания) и определить уровень насыщения организма кислородом. Если прибор фиксирует апноэ и гипоксию, значит храп угрожает здоровью и жизни — в этом случае рекомендуется операция по устранению анатомического дефекта.

Лечение и профилактика храпа ребенка в зависимости от диагноза

Аденоиды

Детская патология, которая, как правило, проходит бесследно к 9–12 годам. Однако в детском возрасте гиперплазия нёбной миндалины может приводить к задержке речи, неправильному формированию лица, глухоте.

Разрастание аденоидов начинается вследствие частых инфекционных заболеваний носоглотки, которые лечатся, в зависимости от возбудителя, противовирусными или антибактериальными препаратами. Для устранения воспаления применяются гормональные и сосудосуживающие спреи. Современные методы позволяют лечить аденоиды консервативно, без удаления. Для профилактики рекомендуется не запускать простудные заболевания, избегать контактов с больными.

Риниты, синуситы и другие воспалительные заболевания носоглотки и гортани

Также могут быть вызваны бактериями или вирусами. Этиологическое (причинное) лечение назначается врачом после установления возбудителя. Профилактика состоит в поддержке иммунитета, избегании переохлаждений.

Аллергические риниты лечатся антигистаминными и местными гормональными препаратами, рекомендуется обследование у аллерголога. Профилактика — гипоаллергенные диета и быт.

Астма

Лечится у пульмонолога. В схеме используются гормональные противовоспалительные препараты, бронхолитики, адреномиметики и др. Астма является хроническим заболеванием, поэтому профилактика будет направлена на продление периодов здоровья (ремиссий), снижение частоты приступов.

Избыточная масса тела

Дети с ожирением обследуются у детского эндокринолога. Решение проблемы лишнего веса с помощью диеты, режима и этиологического лечения устраняет причину храпа.

Дефекты строения глотки и дыхательных путей

СИПАП-терапия — способствует увеличению просвета бронхов при их врожденной узости. Аномалии мягкого нёба — «волчья пасть» и др. — лечатся хирургически.

Лечение храпа у детей современными народными средствами

Для эффективной борьбы с храпом необходимо укреплять мышцы гортани и глотки. Рекомендуется:

  • Выполнение несложной артикуляционной гимнастики (растягивание гласных «и», «ы»)
  • Надувание воздушных шариков с целью тренировки и расширения дыхательных путей
  • Игра на духовых музыкальных инструментах
  • Пение

Кроме того, родители могут создать максимально комфортные условия для сна ребенка:

  • Обеспечить естественное положение шеи и головы во время сна с помощью правильного выбора подушки
  • Следить за положением тела ребенка — при храпе предпочтительно спать на боку, чтобы голова не запрокидывалась
  • Поддерживать оптимальный микроклимат в детской спальне: чаще проводить влажную уборку, увлажнять помещение до необходимых 40–60% влажности, проветривать, обеспечивать оптимальную температуру для сна (18–20 градусов)
  • Создать гипоаллергенный быт и избегать раздражающих продуктов питания, не кормить ребенка на ночь
  • Избегать стрессовых ситуаций перед отходом ко сну

Преимущества лечения храпа у детей в МЕДСИ

  • Опытные доктора педиатрического профиля
  • Возможность получить консультацию всех специалистов в одном месте
  • Современное диагностическое оборудование, которое позволяет выполнять все исследования в одной клинике и обеспечивает высокую точность результатов
  • Доброжелательный профессиональный коллектив — индивидуальный подход к каждому ребенку, быстрый забор материалов, техничное проведение исследований позволяют снизить уровень стресса
  • Возможность аппаратного и хирургического лечения храпа ребенка

Запись на прием по телефону 8 (495) 7-800-500.

Не затягивайте с лечением, обратитесь к врачу сейчас:

  • Лечение храпа
  • Детский ЛОР
  • Аденотонзилотомия

Оренбургская областная клиническая больница

Мы рады приветствовать вас на страницах официального сайта нашей больницы!

Государственное автономное учреждение здравоохранения «Оренбургская областная клиническая больница» (ГАУЗ «ООКБ») свыше 140 лет занимает лидирующее место в здравоохранении области. Благодаря деятельности сотрудников нашего учреждения и бережному отношению к традициям, заложенным нашими предшественниками, мы продолжаем повышать качество и эффективность медицинской помощи. Мощная материально-техническая база, высокий кадровый потенциал, использование эффективных методов диагностики и лечения дают возможность оказывать специализированную, в том числе высокотехнологичную медицинскую помощь населению Оренбургской области и других регионов.

Мощность стационара 933 койки. С 2007 года ГАУЗ «ООКБ» входит в перечень учреждений, оказывающих высокотехнологичную медицинскую помощь по федеральным квотам. С 10 января 2013 в нашей больнице работает региональный сосудистый центр на 120 коек, а 1 января 2014 года на базе нефрологического отделения начал работать областной нефрологический центр.

Мощность консультативной поликлиники 600 посещений в смену, приём ведется по 28 специальностям.

Ежегодно в стационарных отделениях больницы лечатся свыше 24 тысяч пациентов.

Кроме того, ежедневно с выездом на места автомобильным и санитарно-авиационным транспортом специалистами отделения экстренной консультативной медицинской помощи оказывается экстренная помощь при осложнённых заболеваниях, травмах, при необходимости производятся оперативные вмешательства.

Из 404 врачей, работающих в больнице, 4 имеют учёную степень доктора медицинских наук, 33 являются кандидатами медицинских наук, высшая квалификационная категория у 159 врачей. Из 719 средних медицинских работников — у 249 высшая квалификационная категории, 26 медицинских сестёр имеют высшее сестринское образование.

7 врачей нашей больницы носят почётное звание «Заслуженный врач Российской Федерации», 6 – почётное звание «Заслуженный работник здравоохранения Российской Федерации». Нагрудным знаком «Отличник здравоохранения» награждены 31 врач и 6 средних медицинских работников. Почётную грамоту Министерства здравоохранения Российской Федерации имеют 32, почётную грамоту Министерства здравоохранения Оренбургской области – 94 работника больницы.

Совместная работа областной клинической больницы и Оренбургского государственного медицинского университета (института, академии) по подготовке медицинских кадров высшего звена имеет более чем 70-летнюю историю. В настоящее время на нашей базе работают пять кафедр ГБОУ ВПО «Оренбургский государственный медицинский университет».

Для подготовки кадров среднего звена на базе учреждения функционируют вечернее отделение и отделение последипломной подготовки специалистов со средним медицинским и фармацевтическим образованием областного медицинского колледжа.

Наше учреждение имеет лицензию на все осуществляемые виды медицинской деятельности, в том числе на работы и услуги при оказании высокотехнологичной медицинской помощи по 14 специальностям.

Мы надеемся, что наш сайт не только поможет вам найти необходимую информацию, но и оставит у вас самые приятные впечатления.

Главный  врач

ГАУЗ «Оренбургская областная клиническая больница»

 

 

 

 

 

А. В. Редюков


Расстройства аутистического спектра у детей

07.12.2015


Нередко к врачу приходят мамы с жалобами на задержку речевого развития у ребенка. Но у некоторых детей при пристальном взгляде специалист помимо этого, видит особенности поведения ребенка, которые отличаются от нормы и настораживают

Рассмотрим клинический пример:

Мальчик С. Возраст 2 года 9месяцев. Со слов мамы, словарный запас у ребенка не более 20 отдельных слов, состоящих из двух-трех слогов. Фраз нет. Мама говорит, что у ребенка часто бывают истерики, неусидчив, трудно засыпает. Других жалоб мама ребенка не предъявляет. При осмотре врач замечает, что ребенок не смотрит в глаза, все время находится в движении, реагирует криком, если ему, что-то не дают или запрещают. Успокоить ребенка можно только дав ему мобильный телефон или планшет. Проявляет интерес не к детским игрушкам, а больше к блестящим предметам мебели и интерьера. Начиная играть во что-либо, быстро теряет интерес и переключается на другое. Расспрашивая маму, выясняется, что ребенок очень избирателен в еде. Не приучен к горшку, дефекация только в памперс в положении стоя. Плохо засыпает и просыпается во время сна. Ребенку проведена Электроэнцефалография и консультации клинического психолога и логопеда. По результатам диагностики и клинической картины поставлен диагноз – Расстройство аутистического спектра.

Расстройства аутистического спектра (РАС) – это комплексные нарушения психического развития, которые характеризуются социальной дезадаптацией и неспособностью к социальному взаимодействию, общению и стереотипностью поведения (многократные повторения однообразных действий).

Еще в середине прошлого века аутизм был довольно редким заболеванием. Но со временем стало появляться все больше детей, страдающих этим нарушением. Статистика показывает, что частота встречаемости РАС у детей за последние 30-40 лет в странах, где проводится такая статистика, поднялась от 4-5 человека на 10 тысяч детей до 50-116 случаев на 10 тысяч детей. При этом мальчики больше подвержены этому заболеванию, чем девочки (соотношение примерно 4:1).

Причины вызывающие РАС.

Во всем мире до сегодняшнего дня ученые изучающие причины возникновения аутизма не пришли к единому мнению. Выдвигается множество предположений. Среди возможных факторов появления у детей этого нарушения называют некоторые гипотезы:

— гипотеза о генетической предрасположенности

— гипотеза, в основе которой лежат нарушения развития нервной системы (аутизм рассматривается, как заболевание, вызванное нарушениями развития мозга на ранних этапах роста ребенка).

— гипотезы о влиянии внешних факторов: инфекции, химические воздействия на организм матери в период беременности, родовые травмы, врожденные нарушения обмена веществ, влияние некоторых лекарственных средств, промышленные токсины.

Но действительно ли данные факторы могут привести к появлению аутизма у детей, до сих пор не выяснено.

Особенности психического развития детей с РАС.

Чтобы понять и распознать наличие аутизма у ребенка родителям надо внимательно следить за поведением ребенка, замечать необычные признаки, которые не свойственны возрастной норме. Чаще всего эти признаки можно выявить у детей в возрасте до 3-х лет.

Детский аутизм рассматривается, как нарушение развития, которое затрагивает все сферы психики ребенка: интеллектуальную, эмоциональную, чувствительность, двигательную сферу, внимание, мышление, память, речь.

Нарушения речевого развития: в раннем возрасте можно отметить отсутствие или слабое гуление и лепет. После года становится заметно, что ребенок не использует речь для общения со взрослыми, не отзывается на имя, не выполняет речевые инструкции. К 2-м годам у детей очень маленький словарный запас. К 3-м годам не строят фразы или предложения. При этом дети часто стереотипно повторяют слова (часто непонятные для окружающих) в виде эхо. У некоторых детей отмечается отсутствие развития речи. У других же речь продолжает развиваться, но при этом все равно присутствуют нарушения коммуникации. Дети не используют местоимения, обращения, говорят о себе в третьем лице. В некоторых случаях отмечается регресс ранее приобретенных навыков речи.

Трудности в общении и отсутствие эмоционального контакта с окружающими: Такие дети сторонятся тактильного контакта, практически полностью отсутствует и зрительный контакт, присутствуют неадекватные мимические реакции и трудности в использовании жестов. Дети чаще всего не улыбаются, не тянутся к родителям и сопротивляются попыткам взять взрослым их на руки. У детей с аутизмом отсутствует способность выражать свои эмоции, а также распознавать их у окружающих людей. Отмечается отсутствие сопереживания другим людям. Ребенок вместе со взрослым не сосредотачивается на одной деятельности. Дети с аутизмом не идут на контакт с другими детьми или избегают его, им трудно сотрудничать с остальными детьми, чаще всего они склонны уединяться (трудности в адаптации к окружающей среде).

Нарушение исследовательского поведения: детей не привлекает новизна ситуации, не интересует окружающая обстановка, не интересны игрушки. Поэтому дети с аутизмом чаще всего используют игрушки необычно, например, ребенок может не катать машинку целиком, а часами однообразно крутить одно из её колёс. Или не понимая предназначения игрушки использовать её в других целях.

Нарушения пищевого поведения: ребенок с аутизмом может быть крайне избирательным в предлагаемых продуктах, еда может вызывать у ребенка брезгливость, опасность, нередко дети начинают обнюхивать пищу. Но вместе с этим дети могут пытаться съесть несъедобную вещь.

Нарушение поведения самосохранения: в силу большого количества страхов ребенок часто попадает в ситуацию, опасную для себя. Причиной может быть любой внешний раздражитель, который вызывает у ребенка неадекватную реакцию. Например, внезапный шум может заставить ребенка убежать в случайно выбранном направлении. Также причиной является игнорирование реальных угроз жизни: ребенок может очень высоко залезть, играть с острыми предметами, перебегать дорогу не глядя.

Нарушение моторного развития: как только ребенок начинает ходить, у него отмечают неловкость. Также некоторым детям с аутизмом присуще хождение на носочках, весьма заметно нарушение координации рук и ног. Таких детей очень трудно научить бытовым действиям, им достаточно тяжело дается подражание. Вместо этого у них развиваются стереотипные движения (совершать однообразные действия в течении долгого времени, бегать по кругу, раскачивания, взмахи «как крыльями» и круговые движения руками), а также стереотипные манипуляции с предметами (перебирание мелких деталей, выстраивание их в ряд). Дети с аутизмом с заметным трудом осваивают навыки самообслуживания. Выражена моторная неловкость.

Нарушения восприятия: трудности в ориентировке в пространстве, фрагментарность в восприятии окружающей обстановки, искажение целостной картины предметного мира.

Трудности в концентрации внимания: дети с трудом сосредотачивают внимание на чем-то одном, присутствует высокая импульсивность и неусидчивость.

Плохая память: часто и родители и специалисты замечают, что дети с аутизмом хорошо запоминают то, что для них значимо (это может вызывать у них удовольствие или страх). Такие дети на долгое время запоминают свой испуг, даже если он произошел очень давно.

Особенности мышления: специалисты отмечают трудности в произвольном обучении. Также дети с аутизмом не сосредотачиваются на осмыслении причинно-следственных связей в происходящем, присутствуют трудности переноса освоенных навыков в новую ситуацию, конкретность мышления. Ребенку сложно понять последовательность событий и логику другого человека.

Поведенческие проблемы: негативизм (отказ слушать инструкции взрослого, выполнять с ним совместную деятельность, уход из ситуации обучения). Часто сопровождается сопротивлением, криками, агрессивными вспышками. Огромной проблемой являются страхи таких детей. Обычно они непонятны окружающим, потому что зачастую дети не могут их объяснить. Ребенка могут пугать резкие звуки, какие-то определенные действия. Еще одно поведенческое нарушение – агрессия. Любое расстройство, нарушение стереотипа, вмешательство внешнего мира в жизнь ребенка может спровоцировать агрессивные (истерику или физическую атаку) и аутоагрессивные вспышки (повреждения себя самого).

Каждый случай заболевания очень индивидуален: аутизм может иметь большинство перечисленных признаков в крайней степени проявления, а может проявляться лишь некоторыми еле заметными особенностями.


Диагностика расстройств аутистического спектра

Для диагностики аутизма специалисты используют критерии 2-х международных классификаций: МКБ-10 и DSM-5.

Но главные три критерия («триада» нарушений), которые можно выделить это:

— нарушение социальной адаптации

— нарушения в коммуникативной сфере

— стереотипность поведения

В основные диагностические этапы входит:

— осмотр ребенка психиатром, неврологом, психологом

— наблюдение за ребенком и заполнение «Оценочной шкалы аутизма», при помощи которой можно установить тяжесть расстройства

— беседа с родителями

— заполнение родителями опросников – «Опросник для диагностики аутизма»

Виды РАС

Существует несколько действующих классификаций РАС, причем разделение происходит зачастую по совсем разным признакам, что, естественно, может принести определённое неудобство человеку, изначально мало знакомому с медициной или психологией; поэтому ниже будут выделены самые основные и часто встречающиеся на практике виды РАС: — Синдром Каннера( Ранний детский аутизм) — характеризуется «триадой» основных нарушение: трудностью установления контактов со внешним миром, стереотипичностью в поведении, а также задержкой или нарушением коммуникативных функций речевого развития. Также необходимо отметить условие раннего появления данных симптомов (примерно до 2,5 лет)

Проявляется у детей в 4-х формах в зависимости от степени отгораживания от внешнего мира:

Полная отрешенность от происходящего. Эта группа характеризуется отсутствием речи и невозможностью организовать ребенка (наладить зрительный контакт, добиться выполнения инструкций и поручений). При попытках взаимодействия с ребенком, он демонстрирует наибольший дискомфорт и нарушение активности.

Активное отвержение. Характеризуется более активным контактом с окружающей средой, чем первая группа. Нет такой отрешенности, но присутствует неприятие части мира, которая неприемлема ребенку. Ребенок проявляет избирательное поведение (в общении с людьми, в еде, в одежде)

Захваченность аутистическими интересами. Характеризуется образованием сверхценных пристрастий (годами ребенок может говорить на одну и ту же тему, рисовать один и тот же сюжет). Взгляд таких детей направлен на лицо человека, но смотрят они «сквозь» этого человека. У таких детей вызывает удовольствие стереотипное воспроизведение отдельных впечатлений.

Чрезвычайная трудность организации общения и взаимодействия. Аутизм в наиболее легкой форме. Для детей характерна повышенная ранимость, контакт с миром прекращается при малейшем ощущении препятствий. С такими детьми можно установить глазной контакт

— Синдром Аспергера. Формируется с рождения. У детей наблюдается раннее начало речевого развития, богатый словарный запас, развитое логическое мышление, не отмечается нарушений в умственном развитии. Но при этом страдает коммуникативная сторона речи: такие дети не умеют устанавливать контакт с другими людьми, не слушают их, могут беседовать сами с собой, не соблюдают в общении дистанцию, не умеют сопереживать другим людям.

— Синдром Ретта. Особенность его заключается в том, что развитие ребёнка до 1—1,5 лет протекает нормально, но потом начинают распадаться только что приобретённые речевые, двигательные и предметно-ролевые навыки. Характерным для данного состояния являются стереотипные, однообразные движения рук, их потирание, заламывание, при этом не носящие целенаправленного характера. Самое редкое из представленных заболеваний, встречающееся практически всегда только у девочек.

— Детский психоз. Первые проявления симптомов до 3х лет. Характеризуется нарушениями социального поведения, коммуникативными нарушениями. Присутствуют стереотипии в поведении (дети однообразно бегают по кругу, покачиваются стоя и сидя, перебирают пальцы рук, потряхивают кистями). Такие дети имеют нарушения в приеме пищи: они могут проглатывать пищу не жуя. Речь их неясная иногда может представлять собой бессвязный набор слов. Бывают периоды, когда дети застывают на месте, как куклы.

— Атипичный аутизм. Отличается от аутизма по возрастному проявлению и отсутствием одного критерия из «триады» основных нарушений.


Коррекция больных с РАС 

Одним из самых важных разделов абилитации для детей с РАС, несомненно, является оказание психокоррекционной и социально-реабилитационной помощи, с формированием навыков социального взаимодействия и адаптации. Комплексная психокоррекционная работа, включающая в себя все разделы и виды реабилитационной помощи, о которых будет написано ниже, является, наряду с медикаментозной терапией, действенным средством купирования негативных симптомов РАС, а также способствует нормальному включению ребенка в социум. Виды коррекции РАС: 

1) Психологическая коррекция — самый распространённый и известный вид; характерен достаточно широким спектром методик, из которых наибольшее распространение и признание в мире получили программы TEACCH и ABA-терапия.

Первая программа основывается на следующих принципах:

— Особенности каждого отдельного ребёнка интерпретируются исходя из наблюдений за ним, а не из теоретических представлений;

— повышение адаптации осуществляется как путём обучения новым навыкам, так и путём приспособления уже имеющихся к окружающей среде;

— создание индивидуальной программы обучения для каждого ребёнка; использование структурированного обучения; целостный подход к интервенции.

Вторая же программа во многом опирается научение, зависящее от последствий, возникших после поведения. Последствия могут быть в виде наказания или поощрения. В данной модели необходимо выделить основные методы, такие, как процедура создания контура и подкрепления поведения, похожего на целевое; метод обучения цепочек поведения; методика обучения различение стимулов. 

2) Нейропсихологическая коррекция — данный вид включает в себя комплекс занятий, состоящих из растяжек, дыхательных, глазодвигательных, мимических и других упражнений для развития коммуникативной и когнитивной сферы, причем сами занятия между собой заметно различаются по времени и количеству. 

3) Работа с семьей и окружением ребёнка — в первую очередь, данный вид коррекции направлен на смягчение эмоциональной напряжённости и тревоги у членов семьи, так как зачастую родители детей с РАС так же нуждаются в помощи, включающую в себя психотерапевтическую поддержку и программы тренингов (такие программы направлены в основном на формирование чувств понимания проблемы, реальности её решения и осмысленности поведения в сложившейся семейной ситуации).

4) Психосоциальная терапия — собственно, работа с самим ребёнком по формированию когнитивных, эмоциональных и мотивационно-волевых ресурсов личности для возможности дальнейшей социальной адаптации, необходимость в которой проявляется всё ярче по мере взросления ребёнка с РАС. 

5) Логопедическая коррекция — учитывая тот факт, что нарушение речевого развития является одним из кардинальных проявлений РАС, данный вид работы с ребёнком будет неотъемлемой частью программы коррекции. Характеризуется ориентированностью на формирование словарного запаса, развитие слухового внимания, а также фонетического и речевого слуха.

6) Медикаментозная коррекция РАС. При некоторых формах аутизма необходима лекарственная помощь ребенку. Например, для улучшения концентрации внимания и усидчивости врач может назначить витамины и ноотропные лекарства, улучшающие процессы мышления и стимулирующие речевое развитие. А при высокой импульсивности, агрессии, негативизме, выраженных признаках «ухода в себя» могут помочь препараты психотропного ряда. В ряде случаев Аутизм сочетается с эпилептическими приступами. В таких случаях необходимы препараты предотвращающие приступы. Многие мамы опасаются лекарств. Но лекарства назначаются на определенный период, а не навсегда. Нежелательные явления от лекарственных препаратов бывают редко. А результат от эффекта в большинстве случаев стоит смелости родителей. В каждом случае необходимо индивидуально решать, какая нужна терапия. И врач должен быть способен доходчиво объяснить родителям все вопросы относительно лекарств.

В Детском диагностическом центре в Домодедово есть все возможности для диагностики Расстройств аутистического спектра. Такие как: осмотр детским неврологом, клиническим психологом, логопедом, проведение обследования – электроэнцефалографии и видеоЭЭГмониторинга. А также методики коррекции, такие как АВА-терапия.

Алпацкий Д.А. (главный врач, невролог ДДЦ), Литвинова Е.В. (психолог ДДЦ)

Возврат к списку

1хбет штрих код по мкб 10, вывел деньги с 1xbet на карту а они не пришли | Profile

1хбет штрих код по мкб 10 
                    
              
             
1хбет штрих код по мкб 10
Последней версией является МКБ-10 — десятое издание данной классификации. Врач в больничном также отмечает заболевание по системе мкб. Всего выделяют 22 класса заболеваний. Код по мкб 10: n18 Хроническая болезнь почек. Дополнительные материалы по теме: Штрих-коды стран производителей. Генератор штрих кодов онлайн Получить штрих код по цифровому коду товара. Код диагнозов/заболеваний в международная классификация болезней МКБ-10. У цій статті приведений список кодів Десятого перегляду (версія 2007 р. ) Міжнародної статистичної класифікації хвороб та споріднених проблем охорони здоров’я (відомий як icd-10 або МКХ-10). Цистит код по мкб 10 относится к воспалительным заболеваниям слизистой оболочки и тканей мочевого пузыря, который в зависимости от причин возникновения может принимать совершенно различные формы. Расшифровка кода s00-t98 по справочнику МКБ-10. Болезнь «Травмы, отравления и некоторые другие последствия воздействия внешних причин». Международная классификация болезней 10-го пересмотра (МКБ-10) Электронный справочник МКБ-10. Коды диагнозов, поиск по коду и названию болезни. Нозологическая форма: потеря зубов вследствие несчастного случая, удаления или локальной периодонтальной болезни, атрофия беззубого альвеолярного края. Из 10 вычесть полученное в пункте 5: 10 — 2 = 8; Расчетная цифра совпадает с контрольной — штрих код верен, штаб-квартира компании расположена в Великобритании, возможно там же и произведен товар. Острый аденоидит код по мкб 10 20.
По этому адресу решаются вопросы, связанные с блокировкой счета, мошенничеством, доступом к аккаунту и так далее, 1хбет штрих код по мкб 10.
Вывел деньги с 1xbet на карту а они не пришли
Цистит код по мкб 10 относится к воспалительным заболеваниям слизистой оболочки и тканей мочевого пузыря, который в зависимости от причин возникновения может принимать совершенно различные формы. Международная классификация болезней 10-го пересмотра (МКБ-10) Электронный справочник МКБ-10. Коды диагнозов, поиск по коду и названию болезни. Код диагнозов/заболеваний в международная классификация болезней МКБ-10. Код по мкб 10: n18 Хроническая болезнь почек. Киста почки код мкб 10 может возникнуть по неизвестным причинам. Долгое время признаков болезни нет, но с течением времени появляется боль и другие симптомы. Аденоиды, код по мкб 10: гипертрофия носовых желез. Часто родители слышат во врачебной среде (детских отоларингологов) таинственное и непонятное выражение – «Аденоиды, код по мкб 10 у детей». Определяйте страну производителя и достоверность штрих-кода! Так же, определяйте штрих-код по наименованию товара (искать лучше по одному наименованию). Расшифровка кода c00-d48 по справочнику МКБ-10. Нозологическая форма: потеря зубов вследствие несчастного случая, удаления или локальной периодонтальной болезни, атрофия беззубого альвеолярного края. Гиперурикемия без признаков воспалительного артрита и подагрических узлов. User: 1xbet бесплатный, промокод ставки 1хбет на сегодня бесплатно, Title: New Member, About: 1xbet бесплатный &n. По своей универсальности, сайт 1xbet однозначно выглядит привлекательно и предлагает ассортимент, способный удовлетворить требования любого любителя азартных игр, 1хбет штрих код по мкб 10.
 
Пополнить баланс с бонусом:
Яндекс Деньги, Сбербанк онлайн, Альфаклик, WebMoney (Вебмани, ВМ), Банковская карточка (кредитная или дебетовая) – Credit Card, MoneyBookers, Neteller, EcoCard, Wire transfer, Western union, Check, Xек, Банковский перевод, Манибукерс, Нетеллер, Экокард. Криптовалюты: Bitcoin, Litecoin, Dogecoin, Dash, Ethereum, Monero, ZCash, NEM, DigiByte, Bitcoin gold, Bitcoin Cash, Ethereum Classic, Verge, QTUM, STRATIS, Ripple, USD Coin, TrueUSD, Tether, TRON. 
         
Ставки на спорт лучшие коэффициенты:

Футбол 31, 
Теннис 54, 
Баскетбол 49, 
Хоккей 46, 
Волейбол 55, 
Гандбол 65, 
Бейсбол 13, 
Снукер 66, 
Регби 37, 
Австралийский футбол 32, 
Шахматы 38, 
Бокс 21, 
UFC 12, 
Автогонки 12, 
Американский футбол 63, 
Атлетика 25, 
Биатлон 21, 
Бильярд 54, 
Велоспорт 64, 
Гольф 65, 
Горные лыжи 32, 
Гэльский футбол 68, 
Дартс 16, 
Крикет 20, 
Лыжи 24, 
Лыжное двоеборье 59, 
Нетбол 71, 
Олимпиада 67, 
Парусный спорт 19, 
Прыжки с трамплина 20, 
Сёрфинг 75, 
Спидвей 74, 
Флорбол 72, 
Формула-1 28, 
Херлинг 33, 
Хоккей с мячом 54 
 
Life 1xbet, 1хбет штрих код фото
Участник пари самостоятельно выбирает промокод на любую сумму и на тот вид спорта, который его интересует, 1хбет штрих код по мкб 10. Сумма не должна превышать размер бонусных средств. Чтобы воспользоваться этим предложением, зайдите в магазин 1xBet и купите выигрышную ставку. Чтобы принять участие в розыгрыше джекпота, необходимо ежедневно делать ставки, отвечающие определенным условиям. В рамках акции учитываются ставки Live и по Линии. 1xbet полная версия, 1xbet полная версия сайта скачать Сайт для компьютеров довольно нагруженный, что делает его не совсем подходящим для использования с телефона, 1хбет штрих код по мкб 10.
Далее в появившемся справа в купоне ставки указываем сумму и завершаем размещение ставки, вывел деньги с 1xbet на карту а они не пришли. https://superselfinstitute.com/groups/%d0%be%d1%80%d0%b5%d0%bb-%d0%b8-%d1%80%d0%b5%d1%88%d0%ba%d0%b0-%d0%b8%d0%b3%d1%80%d0%b0%d1%82%d1%8c-%d0%be%d1%80%d0%b5%d0%bb-%d0%b8-%d1%80%d0%b5%d1%88%d0%ba%d0%b0-1xbet-%d0%b2%d0%b8%d0%b4%d0%b5%d0%be/

Принцип работы зеркала 1xBet. Популярные сайты для ставок на спорт создают свои рабочие копии, которые называют зеркалами букмекерской конторы, life 1xbet. Они размещаются на других доменах, поэтому доступ на них осуществляется свободно. Сделано это для удобства игроков. Восстановить логин 1xbet, восстановить логин и пароль 1xbet Главные события и реклама бонусных игр имеют удобное расположение и не создают кучности в одном месте. Приложение для Android позволяет клиентам пользоваться практически всеми разделами сайта, делая ставки на спорт максимально удобными, 1хбет штрих код. А это может негативно сказаться на вашей игре, 1хбет штрих код генератор. Допустим нужно срочно перестраховать ставку в лайве или вы занимаетесь вилками. Приложение 1хБет по своим функциональным возможностям ничем не отличается от базовой версии на компьютере, 1хбет штрих код фото. Двухфакторная аутентификация защищает ваш профиль от взлома мошенников, которые могут подбирать логин и пароль к вашему аккаунту, чтобы получить к нему доступ. Основные бонусные программы букмекерской конторы 1xbet. К самым популярным акциям от 1 xbet можно отнести: « Бонус на первый депозит », 1хбет штрих код по мкб 10. Минимум 3 события в экспрессе должны иметь коэффициенты не ниже 1, 1хбет штрих код значение. Сумма, которую игрок должен проставить для выполнения условий бонуса, засчитывается только после того, как все сделанные на эту сумму ставки будут рассчитаны. Быстрая регистрация в системе маркировки. Рассказываем, как это сделать, 1хбет штрих код mmi. Не забывайте, что для доступа к сайту понадобятся рабочие зеркала (или мобильные приложения). Вот это новость от 1xBet, 1хбет штрих код мкб. Отрегулируйте уровень звука, запустив видеоролик до начала съемки. Сейчас можно приступать непосредственно к съемке, 1хбет штрих код html. А это может негативно сказаться на вашей игре, 1хбет штрих код на. Допустим нужно срочно перестраховать ставку в лайве или вы занимаетесь вилками. Беттерам доступны ставки более чем на 35 видов спорта, кроме этого есть возможность заключать пари на лотереи, снукер, скачки. В личном кабинете есть можно смотреть спортивные трансляции, 1хбет штрих код по мкб 10. 
1хбет штрих код по мкб 10, вывел деньги с 1xbet на карту а они не пришлиДля этого необходимо зайти в личном кабинете в историю ставок и найти там пункт с продажей ставки в нужном купоне, 1хбет штрих код по мкб 10. Также можно выставить желаемую сумму продажи ставки, при достижении которой (при изменении котировок) ставка обналичится автоматически. Что значит застраховать ставку? В букмекерской конторе обширная и привлекательная бонусная программа с акциями для постоянных клиентов и новичков. http://observatoriotie.unisabana.edu.co/congreso/community/profile/xbet23810527/ blabla

Тест с ответами «Аденоидит: диагностика и лечение»

Проверь свои знания в тесте «Аденоидит: диагностика и лечение».

1. «Другие хронические болезни миндалин и аденоидов» по МКБ-10 кодируются

1) J03.9
2) J06.9
3) J35.2
4) J35.8

2. «Острая инфекция верхних дыхательных путей неуточненная» по МКБ-10 кодируется

1) J03.9
2) J06.9 
3) J36

3. «Острый фарингит неуточненный» по МКБ-10 кодируется

1) J02.9 
2) J34.2
3) J35.0
4) J35.2
5) J36

4. «Слепым способом» считается выполнение аденотомии

1) в условиях местной анестезии или комбинированной (системные обезболивающие + седативные препараты) 
2) сочетано с деструкцией трубных валиков
3) тонзиллотомом Матье

5. Аденоидит — это

1) воспаление глоточной миндалины 
2) воспаление небной миндалины
3) воспаление язычной миндалины

6. Аденоидит может протекать как

1) латентный
2) острый 
3) подострый
4) хронический

7. Аденоиды — это

1) выбухание задней стенки глотки
2) выбухание надгортанника
3) глоточная (носоглоточная) миндалина 
4) лимфоидная ткань между передней и задней небными дужками
5) рудимент мягкого неба

8. Аденоиды в норме образованы скоплением лимфоидной ткани в полости

1) гортани
2) носа
3) носоглотки

9. Аденотомия может выполняться в следующих условиях

1) латерализации
2) масочного наркоза
3) медиализации
4) местной анестезии или комбинированной (системные обезболивающие + седативные препараты)

10. Аспирация срезанной аденоидной ткани может произойти во время

1) аденотомии в условиях местной анестезии 
2) аденотомии в условиях эндотрахеального наркоза
3) тонзиллэктомии в условиях эндотрахеального наркоза

11. В создании регионарного иммунитета большое значение придается способности миндалин

1) гипертрофироваться
2) отекать
3) покрываться наложениями
4) продуцировать и секретировать в просвет глотки различные биологически активные вещества и клеточные элементы

12. В фармакотерапии аденоидита используют:

1) антисептики 
2) бактериальные лизаты 
3) глицинсодержащие препараты
4) топические и системные антибиотики

13. Венозная сеть глоточной миндалины непосредственно связана с

1) внутричерепными и позвоночными венами 
2) нижней полой
3) портальной веной
4) угловой веной

14. Выберите верное утверждение, связанное с возрастным развитием глоточной миндалины

1) у детей до 15 лет в норме глоточная миндалина не меньше третей степени
2) у детей после 15 лет в норме глоточная миндалина не меньше второй степени
3) у новорожденных глоточная миндалина контурируется в виде 2-6 тонких сагиттальных складок, которые при рождении быстро утолщаются, приобретают вид валиков, между которыми хорошо прослеживаются борозды 
4) у новорожденных глоточная миндалина контурируется в виде шарообразного образования 10 х 40 см

15. Диагностика аденоидита включает:

1) жалобы 
2) радионуклидное исследование аденоидной ткани
3) сбор анамнеза 
4) стандартный оториноларингологический осмотр

16. Из каких отделов состоит глотка?

1) гортаноглотка 
2) носоглотка 
3) ротоглотка 
4) языкоглотка

17. Инволюция аденоидов обычно происходит с

1) 16-17 лет
2) 2-3х лет
3) 20-25 лет
4) 8-9 лет

18. Инструмент для удаления аденоидов называется по автору

1) аденоскоп Риттера
2) аденотом Бекмана 
3) аденотом Макджейсона
4) тонзиллотом Матье

19. К способам эндоскопической аденотомии можно отнести

1) ороэпифарингеальный доступ 
2) транскутанный доступ
3) эдоуральный доступ

20. К этиологическим факторам аденоидита относятся:

1) аллергия 
2) отомикоз
3) плохая аэрация носоглотки 
4) частые эпизоды ОРВИ

21. Клиника аденоидита включает

1) постоянное головокружение
2) эпизоды дисфонии, являющийся проявлением ларингомаляции
3) эпизоды продуктивного кашля (особенно ночью и утром), являющиеся проявлением постназального синдрома

22. Клиника аденоидита включает:

1) амнезию
2) возможное развитие острого или экссудативного среднего отита 
3) нейросенсорную тугоухость
4) частые эпизоды простудных заболеваний (особенно в холодное время года) 
5) эпизоды продуктивного кашля (особенно ночью и утром), являющиеся проявлением постназального синдрома (стекания слизи по задней стенки глотки)

23. Консервативное лечение аденоидита включает следующее:

1) аденотомию
2) назначение мукорегулирующих препаратов 
3) противовоспалительную терапию 
4) тонзиллэктомию

24. Консервативное лечение аденоидита включает следующее:

1) иммунопробинг
2) назначение антимикробных препаратов 
3) назначение пробиотиков 
4) физические методы лечения (физиотерапия) и рефлексотерапия

25. Лечение аденоидита включает:

1) консервативную терапию 
2) хирургическое лечение — аденотомию 
3) хирургическое лечение — конхотомию
4) хирургическое лечение — тонзиллэктомию

26. Лимфоаденоидная ткань в носоглотке представлена

1) глоточной миндалиной 
2) пейеровыми бляшками
3) узлом Розенмюллера

27. Лимфоидно-глоточное кольцо (Вальдейера-Пирогова) включает миндалины:

1) глоточная 
2) сошниковая
3) сфеноидальная
4) трубные

28. Лимфоидно-глоточное кольцо (Вальдейера-Пирогова) включает следующие миндалины:

1) небные 
2) сошниковая
3) хоанальные
4) язычная

29. Методом инструментальной диагностики аденоидита является

1) КТ носоглотки
2) МРТ носоглотки
3) УЗИ щитовидной железы
4) эндоскопическое исследование полости носа и носоглотки

30. Миндалины — орган местного иммунитета лимфоидного аппарата глотки, где происходит активная выработка

1) IgA 
2) адреналина
3) инсулина

31. Основные задачи хирургии носоглотки:

1) восстановление носового дыхания 
2) восстановление проходимости слуховых труб 
3) создание небно-глоточного клапана
4) элиминация очага хронической инфекции в носоглотке

32. Острый аденоидит- это

1) непроходимость наружного слухового прохода
2) острое воспаление глоточной миндалины преимущественно инфекционной этиологии, ассоциированное с острым воспалением ротоглотки или слизистой полости носа, длительность течения которого обычно не превышает 1 месяца 
3) острый асептический процесс в хоанах

33. Острый и хронический аденоидит

1) имеют код по МКБ-10 — J32.5
2) имеют код по МКБ-10 — J35.0
3) имеют код по МКБ-10 — J35.2
4) не выделены в отдельную нозологическую форму

34. Острым аденоидитом можно считать клинические проявления воспаления глоточной миндалины, длительностью

1) более 1 года
2) не более 1 месяца 
3) от 10 месяцев

35. Парной миндалиной является

1) вторичная
2) глоточная
3) трубная 
4) язычная

36. Перечислите особенности строения глотки у детей

1) аденоидные вегетации 
2) малые размеры 
3) отсутствие небных миндалин
4) отсутствие язычной миндалины
5) уплощенная форма

37. По преобладающему этиологическому компоненту аденоидит может быть:

1) аллергический 
2) бактериальный 
3) бактериофагальный
4) вирусный 
5) грибковый

38. По типу воспалительной реакции можно выделить:

1) гнойную форму аденоидита 
2) отёчно-катаральную форму аденоидита 
3) полипозно-складчатую форму аденоидита

39. При проведении аденотомии под зеркально-микроскопическим контролем позиция хирурга

1) билатеральная
2) краниальная 
3) монополярная

40. Регионарными лимфатическими узлами для глоточной миндалины являются:

1) паховые
2) передние шейные 
3) подмышечные
4) поднижнечелюстные

41. Системная антибактериальная терапия аденоидитов у детей может включать

1) аминогликозиды
2) защищенные аминопенициллины 
3) фторхинолоны

42. Сколько трубных миндалин присутствует в носоглотке?

1) 1 миндалина
2) 2 миндалины 
3) 3 миндалины
4) 4 миндалины

43. Трансназальный доступ при аденотомии характеризуется следующим:

1) не всегда позволяет оперировать прицельно область глоточного устья слуховой трубы, структуры в хоане
2) невозможностью выполнения хирургических вмешательств при деформациях в полости носа, у детей раннего возраста, рубцово-спаечный процесс в полости носа
3) неудобство для хирурга правши

44. У детей заглоточное пространство

1) имеет большое количество лимфатических узлов 
2) крупнее, чем у взрослых
3) отсутствует

45. Хронический аденоидит — это

1) ликворея, периодически возникающая в течение 1 года жизни ребенка
2) хронический асептический процесс в хоанах
3) хроническое полиэтиологичное заболевание, в основе которого лежит нарушение физиологических иммунных процессов глоточной миндалины

46. Что является особенностью глоточной миндалины у детей?

1) инволюция глоточной миндалины обычно происходит с 8-9 лет
2) у детей любого возраста глоточная миндалина не меньше 2 степени
3) у детей любого возраста глоточная миндалина не меньше 3 степени

47. Этиологические факторы аденоидита:

1) ВИЧ-инфекция
2) нейросенсорная тугоухость
3) плохая аэрация носоглотки 
4) хроническая Эпштейн-Барр вирусная инфекция

«СберЗдоровье» запустил бесплатный сервис для определения возможной болезни по симптомам с помощью ИИ Статьи редакции

Сервис с точностью 75-91% предложит диагнозы и порекомендует врача.

  • «СберЗдоровье» (ранее DocDoc), «СберМед ИИ» и лаборатория ИИ «Сбера» запустили бесплатный онлайн-сервис, который поможет определить, к какому врачу следует обратиться при недомогании. Об этом vc.ru сообщил представитель компании.
  • Сервис помогает узнать три возможных диагноза и к какому врачу лучше обратиться. Для этого пользователь должен описать как минимум три симптома в специальном поле, а математическая модель проанализирует введённые данные. Симптомы можно описать своими словами — система понимает сокращения и текст с ошибками.
  • После постановки диагноза система предлагает записаться на приём к врачу или проконсультироваться удалённо через «СберЗдоровье». Чтобы воспользоваться сервисом, не нужно регистрироваться или вводить личные данные.
  • Чтобы обучить нейросеть, в неё загрузили более 4 млн установленных обезличенных диагнозов и их симптомов, рассказали в «СберЗдоровье». В памяти сервиса более 265 вероятных болезней — это 95% диагнозов россиян при первичных обращениях в больницы или поликлиники. Точность постановки диагноза в компании оценили в диапазоне от 75% до 91%.
  • В будущем компания планирует обучить нейросеть определять Covid-19 даже по редким симптомам: при характерных для коронавируса симптомах сервис предупредит о подозрении на болезнь и предложит обратиться в клинику, сдать ПЦР-тест или вызвать скорую.

18 250 просмотров

{ «author_name»: «Лиана Липанова», «author_type»: «editor», «tags»: [«\u0441\u0431\u0435\u0440″,»\u043d\u043e\u0432\u043e\u0441\u0442\u044c»,»\u043d\u043e\u0432\u043e\u0441\u0442\u0438″,»\u0437\u0434\u043e\u0440\u043e\u0432\u044c\u0435″], «comments»: 166, «likes»: 42, «favorites»: 65, «is_advertisement»: false, «subsite_label»: «services», «id»: 183124, «is_wide»: true, «is_ugc»: false, «date»: «Wed, 02 Dec 2020 13:02:04 +0300», «is_special»: false }

{«id»:373364,»url»:»https:\/\/vc.ru\/u\/373364-liana-lipanova»,»name»:»\u041b\u0438\u0430\u043d\u0430 \u041b\u0438\u043f\u0430\u043d\u043e\u0432\u0430″,»avatar»:»0bfc4a78-cd85-67dc-167e-b4834ca1c5cd»,»karma»:39164,»description»:»»,»isMe»:false,»isPlus»:true,»isVerified»:false,»isSubscribed»:false,»isNotificationsEnabled»:false,»isShowMessengerButton»:false}

{«url»:»https:\/\/booster.osnova.io\/a\/relevant?site=vc»,»place»:»entry»,»site»:»vc»,»settings»:{«modes»:{«externalLink»:{«buttonLabels»:[«\u0423\u0437\u043d\u0430\u0442\u044c»,»\u0427\u0438\u0442\u0430\u0442\u044c»,»\u041d\u0430\u0447\u0430\u0442\u044c»,»\u0417\u0430\u043a\u0430\u0437\u0430\u0442\u044c»,»\u041a\u0443\u043f\u0438\u0442\u044c»,»\u041f\u043e\u043b\u0443\u0447\u0438\u0442\u044c»,»\u0421\u043a\u0430\u0447\u0430\u0442\u044c»,»\u041f\u0435\u0440\u0435\u0439\u0442\u0438″]}},»deviceList»:{«desktop»:»\u0414\u0435\u0441\u043a\u0442\u043e\u043f»,»smartphone»:»\u0421\u043c\u0430\u0440\u0442\u0444\u043e\u043d\u044b»,»tablet»:»\u041f\u043b\u0430\u043d\u0448\u0435\u0442\u044b»}},»isModerator»:false}

Блоги компаний

Еженедельная рассылка

Одно письмо с лучшим за неделю

Проверьте почту

Отправили письмо для подтверждения

Последние достижения и молекулярный путь лечения аденоидной кистозной карциномы слюнной железы (обзор)

[1]

Spiro RH. Отдаленные метастазы при аденоидно-кистозной карциноме слюнного происхождения. Am J Surg 1997; 01174 (5): 495-98.

[2]

Ellington CL, Goodman M, Kono SA, Grist W, Wadsworth T., Chen AY. Аденоидно-кистозная карцинома головы и шеи: тенденции заболеваемости и выживаемости на основе данных эпиднадзора за 1973-2007 гг., Эпидемиологии и конечных результатов. Cancer-Am Cancer Soc 2012; 15118 (8): 4444-51.

[3]

Кайра К., Тойода М., Шино М., и др. Клинико-патологическое значение экспрессии переносчика 1 аминокислот L-типа (LAT1) у пациентов с аденоидно-кистозной карциномой. Патол Онкол Рес 2013; 0119 (4): 649-56.

[6]

Брэдли П.Дж. Оценка и лечение аденоидной кистозной карциномы: прогресс с оптимизмом. Curr Opin Otolaryngol 2017; 0125 (2): 147-53.

[7]

Papaspyrou G, Hoch S, Rinaldo A, et al. Химиотерапия и таргетная терапия аденоидно-кистозного рака головы и шеи: обзор. Head Neck 2011; 0133 (6): 905-11.

[8]

Лю XY, Лю ZJ, He H, Zhang C, Wang YL. MicroRNA-101-3ps подавляет пролиферацию клеток, инвазию и повышает химиотерапевтическую чувствительность при аденоидно-кистозной карциноме слюнных желез, воздействуя на Pim-.1. Am J Cancer Res 2015; 5 (10): 3015-29.

[10]

Zhou B, Li T, Liu Y, Zhu N. Предварительное исследование гена XAGE-1b и его механизма стимулирования роста опухолевых клеток.Biomed Rep 2013; 1 (4): 567-72.

[11]

Сяо Ц., Пан И, Цзэн Х, и др. Понижающая регуляция индуцируемого гипоксией фактора-1альфа подавляет рост, инвазию и ангиогенез клеток аденоидной кистозной карциномы слюны человека в условиях гипоксии. Oncol Rep 2018; 40 (3): 1675-83.

[12]

Li Z, Tang P, Xu Z. Клинико-патологическое значение плотности микрососудов и экспрессии фактора роста эндотелия сосудов при аденоидно-кистозной карциноме слюнных желез.Китайский J Stomat 2001; 36 (3): 212-4.

[13]

Кондо С., Мукудаи Ю., Сога Д., Нисида Т., Такигава М., Широта Т. Дифференциальная экспрессия фактора роста эндотелия сосудов в клеточных линиях с высоким и низким уровнем метастазирования аденоидно-кистозных слюнных желез. Int J Can Res Treat 2014; 34 (2): 671-7.

[14]

Ou YK, Liang J, Yang ZN, Zhao JJ. Исследование ингибирования экспрессии VEGF в клетках аденоидно-кистозной карциномы слюнных желез с помощью РНКи гена iNOS in vitro.J Oral Pathol Med 2015; 44 (2): 153-8.

[15]

Лю X, Ву Х, Хуанг П., Чжан Ф. Ингибирование JQ1 и PI3K синергетически снижает злокачественность аденоидной кистозной карциномы слюнной железы, воздействуя на сигнальные пути c-Myc и EGFR. J Oral Pathol Med 2018; 48 (1): 43-51.

[17]

Ван И, Ху Дж, Ван И, и др. Активация EGFR индуцировала клетки аденоидно-кистозной карциномы улитки, зависимые от улитки и myc-зависимого PD-L1. Cell Cycle 2018; 17 (12): 1457-70.

[19]

Hu B, Xiong Y, Ni R, et al. Понижающая регуляция ErbB3-связывающего белка 1 (EBP1) связана с плохим прогнозом и повышенной пролиферацией клеток при гепатоцеллюлярной карциноме. Mol Cell Biochem 2014; 396 (1-2): 175-85.

[20]

Sun J, Luo Y, Tian Z, Gu L, Xia SC, Yu Y. Экспрессия ERBB3-связывающего белка 1 (EBP1) в аденоидной кистозной карциноме слюны и ее клиническое патологическое значение. BMC Рак 12: 499.

[21]

Цю Ч.В., Лю Цзы, Хоу К., и др. Нокаут Wip1 ингибирует нейрогенез, воздействуя на сигнальный путь Wnt / бета-катенин при очаговой ишемии головного мозга у мышей. Exp Neurol 2018; 309: 44-53.

[22]

Peng TS, He YH, Nie T, et al. PPM1D является прогностическим маркером и терапевтической мишенью при колоректальном раке. Exp Ther Med 2014; 8 (2): 430-4.

[23]

Тан ИЛ, Лю Х, Гао С.Ю., и др. WIP1 стимулирует миграцию и инвазию аденоидной кистозной карциномы слюнной железы, индуцируя MMP-9 и VEGF-C.Онко-Таргет 2015; 6 (11): 9031-44.

[24]

Карин М., Бен-Нерия Й. Фосфорилирование встречается с убиквитинированием: контроль активности NF- [каппа] B. Анну Рев Иммунол 2000; 18: 621-63.

[25]

Xu D, Li D, Lu Z, Dong X, Wang X. Рецептор TGF-бета типа III ингибирует пролиферацию и миграцию клеток в аденоидно-кистозной карциноме слюнных желез, подавляя передачу сигналов NF-kappa B. Oncol Rep 2016; 35 (1): 267-74.

[26]

Fujioka S, Sclabas GM, Schmidt C, et al. Функция ядерного фактора каппа B в метастазах рака поджелудочной железы. Clin Cancer Res 2003; 9 (1): 346-54.

[27]

Zhang J, Peng B, Chen X. Экспрессия ядерного фактора, индуцируемой каппа-синтазы оксида азота и фактора роста эндотелия сосудов при аденоидно-кистозной карциноме слюнных желез: корреляция с ангиогенезом и клиническим исходом. Clin Cancer Res 2005; 11 (20): 7334-43.

[28]

Лю З., Хуанг С., Чжан С., и др. Подавление активности NF-kappaB мутантом I kappa B alpha: молекулярная мишень для радиосенсибилизации аденоидно-кистозной карциномы. Oncol Lett 2013; 5 (4): 1375-81.

[29]

Хонма К., Мията Т., Очия Т. Ген коллагена типа I подавляет рост опухоли и инвазию злокачественных клеток глиомы человека. Cancer Cell Int 2007; 7: 12.

[30]

Фрейтас В.М., Вилас-Боас В.Ф., Пимента, округ Колумбия, и др. SIKVAV, пептид, производный от ламинина альфа1, взаимодействует с интегрином и увеличивает протеазную активность клеточной линии аденоидной кистозной карциномы слюнной железы человека через сигнальный путь ERK1 / 2.Am J Pathol 2007; 171 (1): 124-38.

[31]

Sun J, Yu YC, Luo YX, Tian Z. Экспрессия эритробластного лейкоза вирусного онкогена гомо-log 3 (ErbB-3), связывающего белок-1, матриксные металлопротеиназы, эпителиальный кадгерин в аденоидно-кистозной карциноме и корреляционный анализ. Китайский J Stomat 2012; 47 (12): 711-14.

[35]

Wang Y, Ma S, Wang W, et al. Ингибирование сурвивина снижает уровни hif-1α, tgf-β1 и tfe3 при аденоидно-кистозной карциноме слюны.PLoS ONE 2014; 9 (12): e114051.

[36]

Ли Дж., Ли А.С. Стресс-индукция GRP78 / BiP и его роль в развитии рака. Curr Mol 2006; 6 (1): 45-54.

[37]

Кайра К., Тойода М., Симидзу А., и др. Экспрессия маркеров стресса ER (GRP78 / BiP и PERK) при аденоидно-кистозной карциноме. Acta Otolaryngol 2016; 136 (1): 1-7.

[38]

Chiarle R, Fan Y, Piva R, и др. Экспрессия белка 2, связанного с S-фазой киназы, в неходжкинской лимфоме обратно коррелирует с экспрессией p27 и определяет клетки в S-фазе.Am J Pathol 2002; 160 (4): 1457-66.

[40]

Zhang H, Kobayashi R, Galaktionov K, Beach D. p19Skp1 и p45Skp2 являются важными элементами киназы S-фазы циклин A-CDK2. Cell 1995; 82 (6): 915-25.

[43]

Бу LL, Дэн У.В., Хуанг С.Ф., Лю Б., Чжан В.Ф., Сунь З.Дж. Ингибирование STAT3 снижает пролиферацию и инвазию в аденоидно-кистозную карциномуу слюнных желез. Am J Cancer Res 2015; 5 (5): 1751-61.

[44]

Yu GT, Bu LL, Zhao YY, et al. Ингибирование mTOR снижает ангиогенез, связанный с Stat3 и PAI, при аденоидно-кистозной карциноме слюнных желез. Am J Cancer Res 2014; 4 (6): 764-75.

[45]

Fan TF, Deng WW, Bu LL, Wu TF, Zhang WF, Sun ZJ. B7-h4 регулирует миграцию и инвазию в аденоидно-кистозную карциному слюнных желез через сигнальный путь JAK2 / STAT3. Am J Transl Res 2017; 9 (3): 1369-80.

[46]

Лин Л., Амин Р., Гальяно Г. И., и др. Ингибитор STAT3 NSC 74859 эффективен при гепатоцеллюлярном раке с нарушенной передачей сигнала TGFbeta.Онкоген 2009; 28 (7): 961-72.

[47]

Li W, Zou ST, Zhu R, Wan JM, Xu Y, Wu HR. Ген B-клеточной транслокации1 подавляет поведение, связанное с клеточными метастазами, при раке груди. Мол Мед Реп 2014; 9 (6): 2374-80.

[48]

Stein U, Walther W., Arlt F, et al. MACC1, недавно идентифицированный ключевой регулятор передачи сигналов HGF-MET, предсказывает метастазирование рака толстой кишки. Nat Med 2009; 15 (1): 59-67.

[49]

Li H, Liao X, Liu Y, et al. Экспрессия MACC1 и его роль в пролиферации и апоптозе аденоидной кистозной карциномы слюны. J Oral Pathol Med 2015; 44 (10): 810-17.

[50]

Fetsch PA, Abati A, Litman T, et al. Локализация белка, ассоциированного с резистентностью к митоксантрону ABCG2, в нормальных тканях. Cancer Lett 2006; 235 (1): 84-92.

[51]

Ли В., Тамамура Р., Ван Б., и др. Экспрессия ABCG2, CD133 и подпланина при аденоидной кистозной карциноме слюнной железы.BioMed Res Int 2014; 2014: 1-11.

[54]

Perrone F, Da RL, Orsenigo M, et al. PDGFRA, PDGFRB, EGFR и активация нисходящей передачи сигналов в злокачественной опухоли оболочки периферических нервов. НейроОнкол 2009; 11 (6): 725-73.

[57]

Ramer N, Wu H, Sabo E, et al. Прогностическое значение количественного иммуноокрашивания p63 при аденоидно-кистозной карциноме слюнной железы, оцененное с помощью компьютерного анализа изображений. Cancer Am Soc 2009; 116 (1): 77-83.

[58]

Ramer N, Wu H, Sabo E, et al. Прогностическое значение количественного иммуноокрашивания p63 при аденоидно-кистозной карциноме слюнной железы, оцененное с помощью компьютерного анализа изображений. Cancer Am Soc 2010; 116 (1): 77-83.

[62]

Mitani Y, Li J, Rao PH, et al. Комплексный анализ слияния генов MYB-NFIB при аденоидно-кистозной карциноме слюны: частота, вариабельность и клиническое патологическое значение. Clin Cancer Res 2010; 16 (19): 4722-31.

[66]

Ding LC, She L, Zheng DL, et al. Notch-4 способствует метастазированию аденоидной кистозной карциномы слюны. Oncol Rep 2010; 24 (2): 363-8.

[70]

Moon RT, Kohn AD, De Ferrari GV, Kaykas A. WNT и передача сигналов бета-катенина: болезни и методы лечения. Nat Rev Genet 2004; 5 (9): 691-701.

[71]

Ван Р., Гэн Н., Чжоу Ю., и др. Аберрантная передача сигналов Wnt-1 / бета-катенина и дефицит WIF-1 являются важными событиями, которые способствуют инвазии опухолевых клеток и метастазированию в аденоидно-кистозную карциному слюнных желез.Biomed Mater Eng 2015; 26 (Дополнение 1): S2145-53.

[72]

Wendt MK, Tian M, Schiemann WP. Разбор механизмов и последствий ТФР-бета-индуцированной ЭМП во время прогрессирования рака. Cell Tissue Res 2012; 347 (1): 85-101.

[73]

Dong L, Wang YX, Li SL, et al. TGF beta1 способствует миграции и инвазии аденоидной кистозной карциномы слюны. J Dent Res 2011; 90 (6): 804-9.

[76]

Ван И, Ху Дж, Ван И, и др. Активация EGFR индуцировала Snail-зависимую EMT и myc-зависимую PD-L1 аденоидно-кистозные клетки слюны человека. Cell Cycle 2018; 17 (12): 1457-70.

[77]

Донг Л., Ге XY, Ван YX, и др. Трансформирующий фактор роста бета и эпителиально-мезенхимальный переход связаны с легочными метастазами при аденоидно-кистозной карциноме. Oral Oncol 2013; 49 (11): 1051-8.

[79]

Омори I, Ямагути Х., Мияке К., Мияке Н., Китано Т.Мутация D816V в петле активации гена KIT обладает большей клеточной пролиферативной и антиапоптотической способностью, чем мутация N822K при остром миелоидном лейкозе, связывающем ядро ​​фактора. Exp Hematol 2017; 52: 56-64.

[81]

Seethala RR, Barnes EL, Hunt JL. Эпителиально-миоэпителиальная карцинома: обзор клинико-патологического спектра и иммунофенотипических характеристик 61 опухоли слюнных желез и верхних отделов пищеварительного тракта. Am J Surg Pathol 2007; 31 (1): 44-57.

[82]

Тан Ю.Л., Фань Ю.Л., Цзян Дж., и др. C-kit вызывает эпителиально-мезенхимальный переход и способствует прогрессированию аденоидно-кистозного рака слюнной железы. Онко-Таргет 2014; 5 (6): 1491-501.

[84]

Кока-Пелаз А, Родриго Дж. П., Брэдли П. Дж., и др. Аденоидно-кистозный рак головы и шеи. Обновленная информация. Oral Oncol 2015; 51 (7): 652-61.

[85]

Cordesmeyer R, Schliephake H, Kauffmann P, et al. Клинические прогностические факторы аденоидной кистозной карциномы слюнной железы: одноцентровый анализ 61 пациента.J Cranio maxillofac Sur. 2017; 45 (11): 1784-87.

транскриптомов определяют отдельные подгруппы аденоидно-кистозной карциномы слюнных желез с различными мутациями и исходами

ВВЕДЕНИЕ

В эпоху точной медицины становится все более важным определять подгруппы пациентов, которые могут реагировать на определенные терапевтические стратегии. Аденоидно-кистозная карцинома (АКК), второе по частоте злокачественное новообразование слюнных желез [1], представляет собой медленно растущую, но агрессивную опухоль с длительным течением заболевания, характерным для местного рецидива и / или метастазирования, которое часто возникает через 5 или более лет после постановки диагноза. [2].Стандартным лечением является хирургическая резекция, но эффективность предотвращения местных рецидивов и отдаленных метастазов варьируется — выживаемость колеблется от менее 3 до более 15 лет, что предполагает необъяснимые фенотипические или молекулярные неоднородности [1, 3]. Попытки разработать целевые методы лечения в основном оказались безрезультатными [4], что подчеркивает необходимость новых и более эффективных терапевтических стратегий.

ACC был тесно связан с онкогеном MYB с момента открытия рекуррентных транслокаций t (6; 9), которые сливают гены MYB и NFIB во многих из этих опухолей [5-7].Протоонкоген MYB кодирует ДНК-связывающий фактор транскрипции, участвующий в различных злокачественных новообразованиях кроветворения, эпителия и нервной системы человека [8-10]. Повторяющаяся транслокация t (6; 9) сливает ген MYB на хромосоме 6 с локусом NFIB на хромосоме 9 и может привести к сверхэкспрессии активированного белка Myb или нового гибридного онкобелка Myb-NFIB. Подробные эпигенетические исследования показали, что транслокация сопоставляет важные энхансеры из локуса NFIB с геном MYB , что приводит к аберрантной сверхэкспрессии онкогена [11].Однако оценки фракции опухолей ACC, которые несут транслокацию t (6; 9) или которые экспрессируют белки Myb или слитые транскрипты MYB NFIB , варьировались [1, 12-17]. Эти расхождения могут быть вызваны множеством факторов, включая небольшие размеры когорт, использование замороженных и архивных материалов FFPE из разных учреждений, разные типы методов обнаружения или даже проблемные антитела, используемые в молекулярных анализах. Путаница привела некоторых авторов к выводу, что MYB вряд ли будет важным драйверным онкогеном в опухолях ACC [18, 19] или даже что партнер слияния NFIB играет более важную функциональную роль, чем ожидалось [20].Эти проблемы стали еще более сложными с открытием альтернативных транслокаций в некоторых опухолях ACC. Например, вместо слияния с геном MYB подгруппа опухолей ACC демонстрирует слияния гена MYBL1 на хромосоме 8, слитого с генами NFIB или RAD51B [17, 21]. MYBL1 кодирует фактор транскрипции A-Myb, который тесно связан с Myb: два белка могут связывать одни и те же последовательности ДНК и могут активировать одни и те же гены-мишени [9, 10].Описана другая подгруппа опухолей ACC, которые имеют точечные мутации в NOTCh2 [22]. Таким образом, несмотря на значительный прогресс, остается неопределенность в отношении степени гетерогенности мутаций ACC, важности различных онкогенов-кандидатов-драйверов в развитии и прогрессе опухоли ACC и, следовательно, каким должен быть соответствующий курс действий для разработки целевых терапевтических агентов.

Поскольку метастазы в опухолях ACC могут развиться через 5 лет и более, привязка молекулярных данных к результатам является сложной задачей из-за необходимости анализа относительно старых образцов, которые, возможно, не были сохранены с учетом анализа РНК или ДНК.Кроме того, были сообщения о том, что несколько предполагаемых клеточных линий ACC были неправильно идентифицированы или могли быть загрязнены другими типами клеток, поэтому исследования, которые основывались в основном на анализах клеточных линий, могут быть скомпрометированы [23, 24]. К счастью, недавние достижения в анализе РНК, полученной из архивных образцов FFPE [17, 25], предоставляют новую возможность для анализа паттернов экспрессии генов в редких опухолях, таких как ACC, с использованием первичных образцов пациентов, которым более десяти лет. Здесь мы описываем беспристрастный РНК-seq анализ самой большой когорты образцов опухолей ACC на сегодняшний день: 68 архивных FFPE опухолей ACC слюнных желез, сопровождаемых ретроспективными клиническими данными, собранными за период 25 лет.Анализ выявил непредвиденную гетерогенность среди пациентов с ACC и предоставил доказательства различных молекулярных сигнатур среди опухолей ACC, а также генов, связанных с плохим исходом, которые могут служить новыми биомаркерами или мишенями для будущих терапевтических стратегий.

РЕЗУЛЬТАТЫ

Анализ последовательностей РНК образцов опухолей АСС в возрасте до 25 лет

В более раннем исследовании мы сравнивали профили последовательностей РНК опухолей АСС с нормальными слюнными железами, но многие из этих образцов опухолей не имели клинических данных. данные вверх [17].Многие пациенты с ОКС выживают более 5 лет после операции, прежде чем погибнут от отдаленных метастазов, что требует анализа относительно старых образцов с информативной информацией о результатах. Мы протестировали улучшенные методы РНК-секвенирования [17, 25], используя небольшой набор образцов ACC, собранных за период до 25 лет назад. РНК выделяли из срезов FFPE и анализировали с использованием методов оптимизированной библиотеки и прибора Ion Proton, преимуществом которого является возможность анализа фрагментов длиной до 25 нуклеотидов.Более 85% исходных образцов, независимо от их возраста, дали данные о последовательности РНК, подходящие для нашего исследования. Мы расширили наш анализ до 77 образцов с периодом наблюдения не менее 5 лет, из которых 68 (88%) дали высококачественные результаты РНК-секвенирования, в среднем ~ 15 × 10 6 прочтений для каждого образца (таблица 1). В среднем 9% считываний однозначно картировались с функциями экзонов. Это все новые образцы ACC, не проанализированные в нашем предыдущем исследовании [17]. На рисунке 1А показано количество считываний, сопоставленных с экзонами, полученными для каждого образца, в зависимости от лет, прошедших с момента сбора образца.Хотя некоторые образцы работали лучше, чем другие, не было существенной корреляции между количеством полученных считываний с картированными экзонами высокого качества и возрастом образцов FFPE (R-квадрат = 0,02). Мы также выполнили несколько типов проверок качества данных РНК-seq и использовали эти результаты для исключения образцов с выбросами [25]. Например, мы сравнили общее количество считываний РНК-seq с считыванием картированных экзонов (рис. 1B) и количество считываний в гене XIST, специфичной для женщин некодирующей РНК, экспрессируемой из молчащей X-хромосомы, в качестве проверки предоставленная гендерная информация (Рисунок 1C).Эти результаты подтвердили, что RNA-seq может предоставить полезную информацию об экспрессии генов из образцов FFPE, даже для архивных образцов, которые были собраны более 10 лет назад.

Таблица 1: Статистика последовательностей РНК

Всего выборок, n

68

Женский

38

Среднее общее число чтений, × 10 –6 (диапазон)

15.17 (4,26–27,98)

Среднее число считываний с отображением экзонов, × 10 –6 (диапазон)

1,41 (0,34–2,68)

избыточное выражение 49 (72%)

MYBL1 сверхэкспрессия

7 (10%)

Нет MYB или MYBL1

12356

51

51

51

Рисунок 1: РНК-seq идентифицирует отдельные подгруппы образцов опухоли ACC.( A ) График количества лет с момента сбора образцов по сравнению с считыванием последовательности РНК, сопоставленной с экзонами в эталонном геноме, показывает, что высококачественные результаты были получены с образцами, собранными до 24 лет назад, и это качество не коррелировало с возраст образцов. ( B ) График общего количества считываний РНК-секвенций против считываний с картированием экзонов, одна из мер контроля качества, используемых в этом исследовании. ( C ) График считываний, сопоставленных с геном XIST, в зависимости от пола, указанного в связанных клинических данных.Этот этап контроля качества полезен для выявления образцов с неправильной маркировкой. ( D ) Представление в браузере генома результатов вызова пика, полученных из данных последовательности РНК образца опухоли АСС для указанных генов. Названия генов и структуры экзонов / интронов находятся вверху, стрелки показывают направление транскрипции, каждая горизонтальная линия или дорожка представляет собой другой образец ACC, упорядоченный для кластеризации образцов с аналогичными паттернами экспрессии генов, а цветные полосы указывают области транскрипции, обнаруженные пиком -Алгоритм вызова.Обратите внимание, что ген MYB транскрибируется слева направо, а остальные — справа налево. Образцы, которые экспрессируют MYB (темно-синий), MYBL1 (голубой) или ни один онкоген (оранжевый), помечены слева.

Большинство опухолей ACC экспрессируют либо

MYB , либо MYBL1

Хотя реаранжировки генов MYB и MYBL1 наблюдались во многих опухолях ACC [17], существуют некоторые разногласия относительно важности онкогенов. [18, 19].Кроме того, коммерчески доступные антитела для измерения уровней белка Myb с помощью иммуногистохимии могут быть проблематичными (данные не показаны), что может способствовать некоторым из отмеченных различий во фракции образцов ACC, которые экспрессируют белки Myb. Чтобы повысить чувствительность, мы начали с необработанных выровненных файлов чтения RNA-seq (например, ‘.bam’) и использовали алгоритм вызова пика для идентификации образцов, которые экспрессировали или не экспрессировали гены MYB или MYBL1 выше фона. . Преимущество алгоритма вызова пика состоит в том, что он также использует считывания, которые сопоставляются с областями интронов, а не только считывания с картированием экзонов, которые мы использовали для количественной оценки экспрессии генов [17, 25].Результаты вызова пика для этих и нескольких других генов показаны на рисунке 1D, где цветные линии указывают область экспрессии гена, определенную алгоритмом вызова пика. Результаты позволили нам разделить образцы на три группы: 49 образцов экспрессировали MYB (темно-синий, верхние образцы), 7 экспрессировали MYBL1 (голубой) и 12 не экспрессировали ни одного онкогена (оранжевый, нижний). В целом 56 из 68 образцов или 82% выражали либо MYB , либо MYBL1 . Интересно, что ни один из образцов не экспрессировал одновременно MYB и MYBL1 , что согласуется с гипотезой о том, что они являются взаимозаменяемыми драйверами онкогенов для большинства опухолей ACC — нет необходимости или давления отбора, чтобы опухоль экспрессировала оба.Алгоритм вызова пика смог различить многие образцы, в которых гены MYB или MYBL1 были усечены из-за транслокаций (обозначенных более короткими линиями, которые не проходят через весь ген). Для сравнения, на рисунке 1D также показаны результаты вызова пика для нескольких других генов: NFIB и NOTCh2 , которые имеют важное значение в опухолях ACC и экспрессируются в большинстве, но не во всех образцах из всех трех групп. и VGLL3 , пример гена, который экспрессировался только в образцах, которые не экспрессировали ни MYB , ни MYBL1 .Ген VGLL3 кодирует фактор транскрипции, участвующий в других эпителиальных опухолях [26, 27], но его значение в ACC не установлено. Мы включаем его здесь в качестве примера только для того, чтобы проиллюстрировать разительные различия в профилях экспрессии генов в этих образцах. Два образца в нашей когорте не экспрессировали NFIB выше фоновых уровней, что позволяет предположить, что экспрессия NFIB не требуется для развития всех опухолей ACC [20]. Однако образцы, которые были положительными, экспрессировали высокие уровни транскриптов, что позволяет предположить, что по крайней мере один аллель гена NFIB был очень высоко экспрессирован в большинстве образцов.

Анализ данных РНК-seq для доказательства слияния транскриптов

Хромосомные транслокации и слияния генов являются важными управляющими мутациями для многих типов лейкемии и солидных опухолей, таких как ACC, но их обнаружение может быть проблематичным. Мы использовали несколько подходов, чтобы попытаться идентифицировать потенциальные слияния генов в данных ACC-опухолевой РНК-seq. Алгоритм вызова пика, описанный на рисунке 1, идентифицировал некоторые опухоли, которые, по-видимому, имели усеченные онкогены. Программа выравнивания с учетом сплайсинга, STAR [28], была использована для идентификации химерных считываний, которые выравниваются с двумя разными генами.Затем кандидатов проверяли путем визуального изучения считываний с помощью браузера генома. Результаты этих усилий суммированы в таблице 2. Несмотря на относительно низкое качество исходной РНК, использованной для этих исследований, и полученную небольшую глубину считывания, мы смогли идентифицировать предполагаемые химерные или гибридные считывания в большой части образцов. Мы идентифицировали считываний слияния MYB-NFIB в 11 образцах и считываний слияния MYBL1-NFIB в 3 образцах. Мы также идентифицировали слияния между генами MYB и PDCD1LG2 или EFR3A в двух дополнительных образцах и проверили эти новые слияния, амплифицируя их с помощью ПЦР на основе геномной ДНК с последующим стандартным (по Сэнгеру) секвенированием (подробности и результаты секвенирования см. дополнительную таблицу 1).Мы идентифицировали 29 образцов, которые, по-видимому, имели укороченные транскрипты гена MYB , где не удалось найти считывания слияния, поэтому партнер слияния остается нехарактеризованным. Точно так же 4 образца, по-видимому, имели усеченные гены MYBL1 на основе данных RNA-seq, но было обнаружено недостаточное считывание слияния для идентификации партнера слияния. Хотя анализ данных РНК-seq позволил идентифицировать множество примеров слитых транскриптов, этот тип анализа не может идентифицировать другие типы слияния или перестройки генов, которые могут не приводить к экспрессии слитых транскриптов, поэтому процент случаев с транслокациями должен считаться заниженной.

Таблица 2: Наблюдаемые и предполагаемые слияния гена MYB , идентифицированные в 68 опухолях ACC

34

Партнер 1

Партнер 2

Кол-во корпусов

MYB

NFIB

т (60003

9356

т (60003 9)

9356

т (60003 9)

т (6; 9)

1

EFR3A

т (6; 8)

50

50 1

т (6 ;?)

29

MYBL 1

NFIB

т (8; 9)

3

Партнер Fusion неизвестен

Опухоли с явным укорочением или транслокацией MYB *

42 (62%)

Опухоли с явным MYBL1 укорочением или транслокацией %)

Общее количество опухолей с явными транслокациями MYB или MYBL1 % *

Опухоли с избыточной экспрессией MYB , но без признаков усечения

7 (10%)

Опухоли, которые не экспрессируют ни MYB , ни MYBL1

12 (18%)

* Основано только на результатах RNA-seq, не подтверждено FISH.

Сигнатуры экспрессии генов идентифицируют основные подгруппы опухолей ACC

В дополнение к группам выживания, описанным выше, наш анализ пиковых значений показал, что опухоли ACC образуют по крайней мере три группы на основе экспрессии MYB , MYBL1 или ни онкогена. Мы охарактеризовали сигнатуры экспрессии генов в опухолях ACC, чтобы исследовать различия или сходства в этих группах. Как показано на рисунке 2A, анализ основных компонентов разделил опухоли ACC на две основные группы.Образцы, которые не экспрессировали ни MYB , ни MYBL1 , сгруппированы в правой части графика (оранжевый). Остальные опухоли, экспрессирующие либо MYB (синий), либо MYBL1 (голубой), были слева и полностью перекрывались, что позволяет предположить, что два онкогена были взаимозаменяемыми и вносили вклад в схожие профили экспрессии генов. Это согласуется с предыдущими исследованиями, показавшими, что замена ДНК-связывающих доменов факторов транскрипции c-Myb и A-Myb, кодируемых генами MYB и MYBL1 , соответственно, привела только к минимальным изменениям в специфичности и активности [29 ].Образцы, не содержащие ни MYB , ни MYBL1 , были специально повторно проверены, чтобы убедиться, что они были правильно диагностированы. Повторное обследование показало, что все случаи представляли собой аденоидно-кистозный рак, состоящий из пациентов с трубчатыми и крибровидными формами без солидных признаков. Большинство из них возникло из небольших участков слюнных желез (см. Дополнительную таблицу 2).

Фигура 2: Анализ дифференциальной экспрессии гена: MYB / MYBL1 по сравнению ни с одним онкогеном. ( A ) Анализ основных компонентов данных последовательности РНК опухоли ACC.Цвета указывают на образцы, которые экспрессируют MYB, (темно-синий), MYBL1, (голубой) или ни один из онкогенов (оранжевый), как определено по результатам определения пиков, приведенным на Фигуре 1D. Обратите внимание, что оранжевые образцы, которые не выражают ни MYB , ни MYBL1 , не отделены от других и образуют свою собственную группу в правой части графика. ( B ) График вулкана, обобщающий анализ дифференциальной экспрессии генов, показывающий log2 кратного изменения по сравнению с log10 значения p (скорректированная BH).Подробности см. В разделе «Материалы и методы». ( C ) Тепловая карта суммирует контролируемую кластеризацию и анализ дифференциальной экспрессии генов, сравнивая образцы, экспрессирующие MYB или MYBL1 (отмечены синим или голубым сверху), с образцами, не экспрессирующими онкоген (отмечены оранжевым сверху). На боковой панели слева показаны гены, которые перечислены в базе данных о взаимодействии генов лекарств. Справа обозначены несколько интересных генов, характерных для этих двух групп. Увеличенная версия этой тепловой карты со всеми помеченными генами представлена ​​в дополнительных результатах (дополнительный рисунок 1).

Для анализа дифференциальной экспрессии генов мы обрабатывали опухоли, экспрессирующие либо MYB , либо MYBL1 (темно-синий или голубой на рисунке 2A), как одну группу и искали гены, отличающие их от опухолей, не экспрессирующих онкоген (оранжевый на рисунке 2A). ). Как показано на графике Volcano на рисунке 2B, наш анализ выявил более 1500 генов, которые были по крайней мере в 2 раза активированы или подавлены, с скорректированным значением p , равным 0,05 или меньше. Тепловая карта, показанная на рисунке 2C, суммирует контролируемый кластерный анализ.Дендрограмма и цветная полоса вверху идентифицируют опухоли, которые экспрессируют либо MYB , либо MYBL1 (справа, темно-синий и голубой), а также опухоли, которые не экспрессируют онкоген (слева, оранжевый).

Из тепловой карты на Рисунке 2C можно сделать несколько важных выводов. Как описано выше, опухоли, экспрессирующие либо MYB , либо MYBL1 , не образуют своих собственных групп и не имеют отдельных сигнатур экспрессии генов. Вместо этого образцы, экспрессирующие MYBL1 , разбросаны среди образцов MYB , что позволяет предположить, что онкогены взаимозаменяемы и что любой из них может быть достаточным в качестве ключевого фактора для этих опухолей.Однако есть доказательства гетерогенности опухолей, экспрессирующих MYB или MYBL1 . Несколько подгрупп видны на дендрограмме вверху и особенно очевидны в верхней половине тепловой карты, которая показывает кластеры опухолей с различными паттернами экспрессии генов.

Другой вывод состоит в том, что существуют сотни или тысячи различий в экспрессии генов между образцами MYB / MYBL1 и опухолями, которые не экспрессируют ни один онкоген.Это было неожиданно, так как все эти опухоли классифицируются как ACC, но объясняет, почему образцы были так легко различимы при анализе основных компонентов (рис. 2A). Несколько интересных генов были выделены и помечены на тепловой карте на рисунке 2C (полноразмерная версия со всеми помеченными генами представлена ​​на дополнительном рисунке 1). Некоторые из наиболее интересных генов, активируемых в опухолях, которые не экспрессируют ни MYB , ни MYBL1. и могут быть потенциальными «драйверами» этой подгруппы опухолей ACC «не MYB» .Напротив, гены наиболее тесно коррелировали с экспрессией MYB или MYBL1 , включая хемокин CXXC4 и факторы транскрипции SOX4 и EN1 . Последний ген, кодирующий транскрипционный фактор энгрализованного гомеобокса 1, был ранее идентифицирован как важный биомаркер опухолей ACC [30]. Ген SOX4 также был ранее идентифицирован как активируемый в опухолях ACC [31]. Наши результаты показывают, что и EN1 , и SOX4 сильно коррелируют с экспрессией MYB / MYBL1 , предполагая, что они могут быть прямыми нижестоящими мишенями, регулируемыми онкогенами.

EN1 и SOX4 — регулируемые Myb гены-мишени в опухолях ACC

Сообщалось о результатах комплексного иммунопреципитации-секвенирования хроматина (ChIP-seq) для образцов опухолей ACC [11]. Мы проанализировали общедоступные данные и подтвердили, что, хотя связывание является слабым, оба промотора EN1 и SOX4 заняты белками Myb в опухолях ACC (данные не показаны). Мы использовали ПЦР для амплификации промоторов каждого гена, клонировали их в плазмиды репортерных генов и протестировали их реакцию на белки Myb в анализах трансфекции / репортерного гена.Диаграммы промоторных областей генов EN1 и SOX4 показаны на рисунке 3А вместе с областями, которые мы клонировали в плазмиды репортерных генов. Оба промотора содержат предсказанные элементы ответа Myb [32, 33], обозначенные красными метками на фрагментах промотора, показанных на фиг. 3A (полная последовательность ДНК каждого клонированного фрагмента представлена ​​в дополнительных данных). Для функциональных анализов мы трансфицировали репортерные плазмиды в клетки HEK293T, в которых отсутствует экспрессия эндогенного белка c-Myb или A-Myb, вместе с контрольной (пустой вектор) плазмидой или плазмидами, экспрессирующими c-Myb дикого типа или MYB NFIB или MYBL1 RAD51B слитых онкогенов, идентифицированных ранее [17].Как показано на рисунке 3B, репортерные гены EN1 (серый) и SOX4 (синий) были сильно (в 3–14 раз) активированы котрансфекцией плазмид, экспрессирующих белки Myb дикого типа или онкогенные. Ни один из промоторов не был значительно активирован вектором отрицательного контроля, экспрессирующим белок c-Myb с мутированным ДНК-связывающим доменом, который не может связывать ДНК (не показано). Эти результаты подтверждают, что как белок c-Myb, кодируемый геном MYB , так и белок A-Myb, кодируемый MYBL1 , могут активировать промоторы EN1 и SOX4 в анализах трансфекции.На основе этих результатов опубликованы результаты ChIP-seq, показывающие, что эти промоторы заняты белками Myb в опухолях ACC, и тесная корреляция между уровнями РНК MYB / MYBL1 , EN1 и SOX4 в образцах опухолей ACC. , мы пришли к выводу, что EN1 и SOX4 , вероятно, являются прямыми мишенями регуляции белков Myb в опухолях ACC. Однако потребуются дополнительные эксперименты, чтобы определить, играют ли эти два Myb-регулируемых гена прямую роль в развитии или патогенезе опухолей ACC.

Рисунок 3: Анализы промоторного репортерного гена EN1 и SOX4 . ( A ) Структура промоторов EN1 и SOX4 и векторов репортерных генов. На диаграммах показан 5′-конец каждого гена с нормальным сайтом начала транскрипции, указанным стрелкой, и фрагментом, используемым для конструкций промотор-репортер, указанных ниже. Красные метки указывают предполагаемые сайты связывания для белков Myb (элементы ответа Myb). Полная последовательность ДНК каждого клонированного фрагмента приведена в разделе «Методы».( B ) Результаты трансфекционного репортерного гена. Плазмиды гена промотора-репортера EN1 и SOX4 котрансфицировали в клетки HEK293T вместе с контрольным (пустым) вектором или плазмидами, экспрессирующими нормальный полноразмерный c-Myb или MYB NFIB или MYBL1 слитые конструкции RAD51B . На диаграммах слева показаны структуры экспрессируемых слитых белков. Гистограмма справа показывает активность репортерного гена люциферазы, нормированную к уровню контрольного (пустой) вектора для плазмид промотор-репортер EN1 (серый) и SOX4 (синий).

Идентификация подгруппы пациентов с ОКС с высоким риском и неблагоприятным исходом

ОКС является морфологически и клинически неоднородным заболеванием, что затрудняет его классификацию и лечение. Наши предыдущие анализы с использованием только 20 образцов опухолей показали, что существует гетерогенность среди опухолей ACC [17]. Чтобы исследовать это дальше, мы выполнили неконтролируемую иерархическую кластеризацию данных экспрессии генов для 68 новых опухолей, создав дендрограмму, показанную на рисунке 4A. Опухоли ACC сформировали две основные группы.Группа 1 (красный, n = 14) была выделена и разделена на дендрограмме, что указывает на то, что образцы сильно различались с точки зрения характеристик экспрессии основных генов. Группа 2 ( n = 54, черный и оранжевый) содержала большинство случаев и состояла из нескольких меньших подгрупп, что подразумевает дополнительную генетическую гетерогенность среди опухолей ACC, которая может быть биологически важной. Все образцы, которые не экспрессировали ни MYB , ни MYBL1 (оранжевый), принадлежали к более крупной группе 2.Мы использовали анализ выживаемости Каплана-Мейера для оценки всех выборок с данными о выживаемости (рис. 4B), который выявил медианное значение выживаемости для всех пациентов с ACC 147 месяцев и 5-летнюю выживаемость 72% (95% доверительный интервал, ДИ: 0,62–0,84). Однако, как показано на рисунке 4C, у 13 пациентов в группе 1 (красный) с информацией о выживаемости средняя выживаемость составила всего 28 месяцев, средняя выживаемость только 54% ​​через 2 года (95% доверительный интервал, ДИ: 0,33–0,89). ) и мрачная выживаемость 31% за 5 лет (95% C.И .: 0,14–0,70). В группе 1 не было пациентов, проживших более 10 лет. Пациенты в группе 2 (черные) показали значительно лучшую выживаемость (лог-ранг p -значение <1 × 10 –5 ) со средней выживаемостью 92% в течение 2 лет (95% ДИ: 0,85–1,0), более выживаемость более 81% за 5 лет (95% ДИ: 0,71–0,93) и 72% за 10 лет (95% ДИ: 0,61–0,87). Группа 2 содержала образцы, которые экспрессировали MYB , плюс все образцы, которые экспрессировали MYBL1 , и все образцы, которые не экспрессировали ни одного онкогена (описано на рисунке 1).При тестировании по отдельности все эти подгруппы показали относительно хорошую выживаемость. График анализа основных компонентов на рисунке 4D объединяет эти кластеры выживаемости с результатами, показанными выше на рисунке 2. Образцы ACC образуют три отдельные группы: образцы группы 1 с низкой выживаемостью (красные) в верхнем левом углу, образцы, которые не экспрессируют ни MYB ни MYBL справа (оранжевый), а остаток MYB или MYBL1 , экспрессирующих образцы, внизу слева (черный).Таким образом, паттерны экспрессии генов определили ранее неизвестную подгруппу пациентов с ACC со значительно худшей общей выживаемостью и разделили пациентов с ACC на три отдельные группы с различными онкогенами-драйверами и исходами.

Рис. 4. Идентификация подгруппы пациентов с ОКС высокого риска. ( A ) Неконтролируемая иерархическая кластеризация: образцы опухоли ACC образуют два основных кластера, обозначенных как Группа 1 (красный) и Группа 2 (оранжевый и черный). ( B ) График выживаемости Каплана-Мейера для всех 68 образцов опухоли ACC с информацией о выживаемости, показывающей медианное значение выживаемости (красный), а также 95% доверительные интервалы (голубой и темно-синий).( C ) Графики выживаемости Каплана-Мейера для образцов опухоли ACC в группах 1 и 2 (красный и черный соответственно). Группы составили 13 и 55 пациентов соответственно. ( D ) Анализ основных компонентов данных последовательности РНК опухоли ACC. Цвета указывают на образцы, которые экспрессируют либо MYB , либо MYBL1 в Группе 1 (красный) или Группе 2 (черный), либо образцы, которые не экспрессируют ни один из онкогенов (оранжевый), как определено по результатам определения пиков, приведенным в Рисунок 1D.Обратите внимание, что образцы, которые не выражают ни MYB , ни MYBL1 (оранжевый), не отделены от других и образуют свою собственную группу в правой части графика. Образцы группы 1 с плохой выживаемостью (красный) кластер в верхнем левом углу графика. ( E ) Тепловая карта суммирует результаты анализа дифференциальной экспрессии генов, сравнивающих образцы ACC группы 1 с плохой выживаемостью (слева, красный) и группы 2 с лучшей выживаемостью (справа). Цветная полоса вверху указывает образцы в Группе 1 (красный) или образцы, которые экспрессируют MYB (темно-синий), MYBL1 (голубой) или ни один онкоген (оранжевый).Справа обозначены несколько интересных генов, активируемых в каждой группе. Увеличенная версия этой тепловой карты со всеми помеченными генами представлена ​​в дополнительной информации в виде дополнительного рисунка 2.

В ряде публикаций сообщалось о маркерах для определения подгрупп с низкой выживаемостью пациентов с ОКС [1, 30, 34–43]. Большинство маркеров были первоначально протестированы с использованием окрашивания антител в иммуногистохимических анализах, а некоторые были разработаны с использованием клеточных линий ACC, подлинность которых была поставлена ​​под сомнение [23, 24].Мы проверили, пригодны ли 20 ранее идентифицированных маркеров для выявления подгрупп с плохой выживаемостью в нашей когорте, используя данные RNA-seq. Результаты, обобщенные в таблице 3, показали, что только MYB, PTK2 (FAK) и SNAI2 (Slug) были полезны для выявления подгрупп опухолей ACC, которые показали значительные различия в выживаемости, на основе использования анализа модели пропорциональных рисков Кокса. . Ни один из других маркеров не дал значимых результатов, хотя неудачи могли отражать разницу между данными экспрессии РНК и экспрессией белка, измеренной с помощью иммуногистохимических анализов.

Таблица 3: Сообщается, что гены связаны с плохим прогнозом при опухолях ACC

[35]

000

9352

0

[41]

19

9352

9352

8

Ген

Ссылка

*

HR **

95% ДИ

p -значение

BMI1

[34]

9.98

0,59

1,61

0,929

CDh2

[34]

9352 9352

9352 9352 9352

0,12

9,43

0,945

EN1

[30]

Плохой результат

52

52 IHC82

0,66

12,01

0,160

EPAS1 (HIF2a)

[35]

[35]

[35]

0,16

0,02

1,25

0,081

FABP7

[61]

9352 9352

0,83

5,81

0,111

ILK

[36]

9352 9352

9352 9352 9352

9352 9352 0,09

3,73

0,555

КОМПЛЕКТ

[37]

Плохой результат

.13

0,17

7,42

0,897

MYB

[1]

[1]

[1]

3,59

0,95

13,53

0,059

9352 9356

9352 9352

IHC

2.11

0,08

54,54

0,653

PDCD4

[39]

9352 9352

9352 9352 9352 9352 0,21

2,26

0,531

PIM1

[40]

Плохой результат

IHC57

0,20

1,58

0,277

PPM1D (WIP1)

[41]

0,55

5,84

0,333

PTEN

[36]

0,01

3,27

0,252

PTK2 (ФАК)

003 [36]

003 [36]

IHC

126,26

2,89

5507,29

0.012

SNAI1 (Улитка)

[34]

Плохой результат

IHC

0,94 9047

5

0,94 9047

5

SNAI2 (Slug)

[34]

Плохой результат

9356

IHC 34

0,13

0,91

0,032

SOD2

0,55

0,10

2,98

0,492

SOX2

[43]

[43]

[43]

[43]

65

0,36

1,16

0,144

TWIST2

[35]

9352

0,50

1,43

0,529

ZEB2 (SIP1)

[35]

9035 QPC

9356 QPC

0,07

3,24

0,453

* IHC = иммуногистохимия; QPCR = количественная ПЦР или другой анализ ПЦР.

** HR = коэффициент риска для увеличения экспрессии гена на одно стандартное отклонение в логарифмической шкале.

Мы также проверили, можно ли использовать какие-либо другие клинические параметры, представленные в нашей когорте образцов, для выделения подгруппы с плохой выживаемостью.Как показано в Таблице 4, мы обнаружили, что возраст на момент операции был значительно связан с общей выживаемостью, если рассматривать его как непрерывную переменную (коэффициент риска, HR = 1,42 на 10 лет). Пациенты в возрасте 50 лет и старше имели более высокий риск, чем пациенты более молодого возраста (HR = 1,34), хотя связь не была статистически значимой. Пол не имел значительной связи с общей выживаемостью, хотя у мужчин риск был немного выше, чем у женщин (HR = 1,27). Как и следовало ожидать, два клинических параметра, описывающих исход, статус рака (либо NED: отсутствие признаков заболевания или наличие опухоли) и статус метастазирования (да или нет) были значительно связаны с плохой выживаемостью.Пациенты с известными метастазами имели значительно более высокий риск, чем пациенты без них (HR = 4,86, p -значение = 0,0008). Пациенты с опухолью имели значительно более высокий риск, чем пациенты без признаков заболевания (NED) (HR = 11,27, p -значение = 0,0013).

Таблица 4: Характеристики 68 опухолей ACC

1 * C.I.

356

Уровень

Общий

HR

p -значение

N

68

, среднее (SD)

50,1 (14,1)

1,42
(за 10 лет)

1,07

1.87

0,0143

Возрастная группа (%)

<50

32 (47,1)

1

50+

36 (52,9)

1,34

0,63

2,86

0,4513

30 (44.1)

1

Мужской

38 (55,9)

1,27

1,27

1,27

9352

Статус метастазов (%)

Нет

36 (57,1)

1

27 (42.9)

4,86 ​​

1,93

12,21

0,0008

Статус рака (%) 300003

NOD0003

1

С опухолью

23 (43,4)

11,27

57

49,51

0,0013

MYB + MYBL1 Выражение

0,123

EN1 Выражение

2.82 *

0,66

12,01

0,1603

Ключ: HR = степень опасности; C.I. = Доверительный интервал; p -значение = p -значение критерия Вальда на основе регрессии Кокса; NED = Нет доказательств заболевания

* HR = Отношение рисков, вызванное увеличением на одно стандартное отклонение

Мы использовали многомерный анализ, чтобы проверить, предоставляют ли группы экспрессии генов дополнительную информацию о выживаемости по сравнению с другими переменными.Как показано в таблице 5, группа 1 кластера экспрессии генов была значимо связана с плохим исходом, даже после поправки на влияние возраста на момент операции и статуса метастазов (HR = 4,76, p -значение <0,001). Аналогичным образом, возраст на момент операции как непрерывная переменная была значимо связана с худшей выживаемостью после поправки на эффекты статуса метастазов и кластера экспрессии генов (HR = 1,55 на 10 лет, p -значение = 0,014), а пациенты с метастазами имели значительно более высокий риск, чем у тех, у кого нет (HR = 3.18, p -значение = 0,027) после поправки на влияние возраста при операции и кластера экспрессии генов. Таким образом, эти три переменные, по-видимому, независимо связаны с плохой выживаемостью. Статус метастазов — это маркер исхода, который оценивается спустя годы после операции и описывает успех лечения. Напротив, паттерны экспрессии генов были определены из хирургических образцов, которые были собраны до того, как стали известны результаты. Таким образом, информация о молекулярных различиях может быть полезна для прогнозирования общей выживаемости и для выявления пациентов, которым требуются различные стратегии лечения или которым может быть полезен более интенсивный последующий уход.

Таблица 5: Многомерный анализ Кокс-регрессии

9351 9351 9351

11,77

Уровень

HR

95% C.I.

p -значение

N

9035 1.55 *
(за 10 лет)

1,10

2,20

0,014

Статус метастазов

Да

3,18

1,14

8,87

0.027

Кластер экспрессии генов

Группа 2

1

<0,001

Условные обозначения: HR = коэффициент опасности; C.I. = Доверительный интервал; p -значение = p -значение теста Вальда на основе регрессии Кокса

* Коэффициент риска, связанный с 10-летним увеличением возраста.

Сигнатуры экспрессии генов определяют подгруппы пациентов с ACC с хорошим и плохим исходом

Мы провели дифференциальный анализ экспрессии генов с использованием групп опухолей ACC, идентифицированных с помощью иерархической кластеризации, и идентифицировали более 2000 генов, которые были значительно (как минимум в 2 раза выше). или вниз, скорректировано на p -val <0,05), различное между двумя группами выживания. Тепловая карта на рисунке 4E сравнивает экспрессию 100 генов, которые наиболее значимо коррелировали с Группой 1 (низкая выживаемость, слева, цветная полоса: красная) или Группой 2 (лучшая выживаемость, справа, цветная полоса: оранжевая, синяя или голубая).Гены с повышенной регуляцией в группе с плохой выживаемостью включали IPO9, ERBB3, SOX4, MYB и GABRP . Гены с повышенной регуляцией в группе с лучшей выживаемостью включали SETBP1, EGFR, TP63 и PIGR (полноразмерная тепловая карта со всеми помеченными генами представлена ​​на дополнительном рисунке 2). Дифференциальная экспрессия ERBB3 и EGFR в группах с плохой и хорошей выживаемостью, соответственно, предполагает различие в сигнальных путях, связанных с переходом эпителия в мезенхиму.Хотя гены сигнатуры WNT не были значительно обогащены в нашем анализе путей, несколько генов в сигнальном пути WNT экспрессировались по-разному, что позволяет предположить, что специфическая сигнатура WNT может быть важной для различий между группами с хорошим и плохим исходом. Однако эта характеристика потребует дополнительных исследований.

Сигнатура экспрессии гена стволовых клеток связана с плохим исходом

Мы использовали анализ обогащения набора генов [44], чтобы выявить различия между подгруппами с плохим и хорошим исходом опухолей ACC.Прямое сравнение двух групп с использованием дифференциально экспрессируемых генов для всех 68 образцов опухолей (рис. 4E) не выявило каких-либо значительно обогащенных путей, возможно, из-за резкой гетерогенности в группе с хорошим исходом, которая содержала образцы, экспрессирующие MYB . , MYBL1 и ни один онкоген. Следовательно, поскольку все образцы Группы 1 экспрессировали MYB , мы сфокусировали наш анализ, сравнивая их только с другими образцами, экспрессирующими MYB .Анализ основных компонентов (рис. 5A) четко отделил 13 образцов в группе 1 с плохим исходом (красный, слева) от 36 образцов, экспрессирующих MYB в группе 2 с лучшим исходом (синий, справа). Используя приблизительно 1000 генов, которые были значительно по-разному экспрессированы между двумя группами опухолей, экспрессирующих MYB , анализ обогащения набора генов выявил несколько списков генов, которые были обогащены в образцах с хорошими результатами в группе 2 (таблица 6). Однако только один список генов был значительно обогащен в группе с плохим исходом (таблица 7).Как показано на Фигуре 5B, ген список «BENPORATH_ES_WITH_h4K27ME3» был значительно ( p val <0,004) обогащен в группе 1. Этот список генов описан как «гены, обладающие триметилированной меткой h4K27 (h4K27me3) в их промоторах в эмбриональных стволовых клетках человека, как определено ЧИП на чипе »[45]. Это говорит о том, что опухоли с плохим исходом обладают характеристиками, связанными с ES-клетками, схожими с опухолями молочной железы, отрицательными по рецепторам эстрогена высокой степени злокачественности, с базальными опухолями, которые также имеют плохой клинический исход [45].Тепловая карта на рисунке 5C суммирует экспрессию генов из этого списка в опухолях Группы 1 (слева, красный) и Группы 2 (синий, справа). Образцы с плохим исходом отличаются относительно высокой экспрессией SOX8 , MYB и TGFA и низкой экспрессией SYNE1 , TBX3 и PTPRT . Эти результаты предполагают, что можно разработать биомаркер экспрессии генов для идентификации пациентов из группы высокого риска и плохого исхода, чтобы их можно было стратифицировать для более интенсивного наблюдения с целью улучшения выживаемости.

Рис. 5: Обогащенный анализ генетического набора образцов MYB . ( A ) Анализ основных компонентов образцов, экспрессирующих MYB . Цвета указывают образцы в Группе 1 (красный, слева) или Группе 2 (синий, справа). Обратите внимание, что образцы группы 1 с плохой выживаемостью образуют отдельную группу в левой части графика. ( B ) График обогащения набора генов «Benporath_ES_with_h4K27me3», идентифицированного с использованием генов, дифференциально экспрессируемых в образцах группы 1 и группы 2, экспрессирующих MYB .( C ) Тепловая карта дифференциально экспрессируемых генов из набора генов «Benporath_ES_with_h4K27me3», идентифицированных с помощью анализа обогащения набора генов.

Таблица 6: Результаты анализа обогащения набора генов: Группа 2

ОБОГАЩЕННЫЙ В ГРУППЕ 2 (ХОРОШИЙ РЕЗУЛЬТАТ)

000 НАЗВАНИЕ ГЕНЕЗИКА

NOM р-Val

ФРГ д-Val

LIM_MAMMARY_STEM_CELL_UP

41

0

0

LIU_PROSTATE_CANCER_DN ​​

42

0

6.08E-04

SENESE_HDAC1_AND_HDAC2_TARGETS_DN

18

0

0,008256009

WANG_SMARCE1_TARGETS_UP

24

0

0,011867385

ONDER_CDh2_TARGETS_2_DN

32

0

0.013505637

MCBRYAN_PUBERTAL_TGFB1_TARGETS_UP

15

0

0,017456258

FORTSCHEGGER_PHF8_TARGETS_DN

18

0

0,022528453

ACEVEDO_FGFR1_TARGETS_IN_PROSTATE_CANCER_MODEL_DN

23

0.001287001

0,022527734

TURASHVILI_BREAST_DUCTAL_CARCINOMA_VS_DUCTAL_NORMAL_DN

29

0,001305483

0,040243994

CHANDRAN_METASTASIS_DN

15

0,001461988

0,02578634

KOINUMA_TARGETS_OF_SMAD2_OR_SMAD3

33

0.002597403

0.05427582

KINSEY_TARGETS_OF_EWSR1_FLII_FUSION_DN

22

0,004166667

0,052254837

PASINI_SUZ12_TARGETS_DN

17

0,004279601

0,034044717

MARTINEZ_RB1_AND_TP53_TARGETS_UP

15

0.005763689

0.07122304

BRUINS_UVC_RESPONSE_LATE

27

0,006648936

0,06798041

JAEGER_METASTASIS_DN

22

0,008310249

0,06001583

CHICAS_RB1_TARGETS_CONFLUENT

33

0.008782936

0,07140977

Таблица 7: Результаты анализа обогащения набора генов: Группа 1

0 GUTCOM

BENPORATH_ES_WITH_h4K27ME3

ОБОГАЩЕННЫЙ В ГРУППЕ 1 (ПОРЯДОК ПОКАЗАТЕЛЯ

РАЗМЕР

NOM р -Val

ПБУ д

-Val

22

0.003861004

0.10307397

ОБСУЖДЕНИЕ

ACC представляет большой класс относительно редких опухолей, которые трудно изучать из-за ограниченных выборок, отсутствия проверенных клеточных линий и неразвитых моделей опухолей. В случае АКК течение болезни может быть медленным, что часто приводит к развитию метастазов через 5 и более лет после постановки диагноза и операции [2]. Это требует изучения относительно старых образцов, чтобы можно было сопоставить молекулярную информацию с клиническими результатами.Для решения этой проблемы мы разработали оптимизированные подходы к RNA-seq [17, 25], чтобы можно было детально проанализировать паттерны экспрессии генов в заархивированных образцах FFPE возрастом до 25 лет. Применяя эти методы к одной из самых больших когорт когда-либо изученных образцов ACC, мы выявили несколько важных подгрупп пациентов с ACC и пролили свет на новые молекулярные детали об онкогенных факторах, на которые могут быть нацелены новые типы терапевтических подходов.

Мы применили новое использование статистического алгоритма вызова пика для идентификации образцов ACC, которые экспрессируют MYB , MYBL1 или ни один онкоген.В дополнение к идентификации трех подгрупп опухолей ACC, этот подход показал, что опухоли ACC в нашей когорте не экспрессировали MYB и MYBL1 , что согласуется с нашей моделью, согласно которой два онкогена являются взаимозаменяемыми драйверами онкогенеза [17]. Четко разделив подгруппы опухолей ACC, мы смогли провести дифференциальный анализ экспрессии генов, чтобы определить характерные для каждой группы сигнатуры экспрессии генов. Около 80% опухолей, которые экспрессировали либо MYB , либо MYBL1 , демонстрировали резко отличные профили экспрессии генов, чем опухоли, которые не экспрессировали ни один из онкогенов (рис. 2).Особо следует отметить гены EN1 (зашифрованные) и SOX4 , которые сильно коррелировали с экспрессией MYB / MYBL1 . Мы исследовали эти два гена, которые кодируют факторы транскрипции, и обнаружили, что промоторы обоих генов предсказывают элементы ответа Myb и активируются эктопически экспрессируемыми белками c-Myb или A-Myb в анализах трансфекционных репортерных генов. В сочетании с опубликованными данными ChIP-seq, показывающими, что промоторы заняты белками Myb в опухолях ACC [11], мы заключаем, что как EN1 , так и SOX4 , вероятно, являются прямыми генами-мишенями, активируемыми с помощью MYB / MYBL1 онкогенные продукты в опухолях ACC, которые экспрессируют один из онкогенов.

Другая группа опухолей ACC не экспрессирует ни MYB , ни MYBL1 , а также не экспрессирует EN1 или SOX4 . Вместо этого они экспрессируют онкогенные факторы транскрипции KLF4 , FOXO1 , JUNB и FOSB и важный регулятор развития VGLL3 . В настоящее время нет других подтверждающих доказательств, указывающих на то, что продукты этих генов действуют как движущие силы туморогенеза в этой подгруппе опухолей ACC, но они кажутся отличными кандидатами для дальнейшего изучения и, возможно, разработки моделей на животных для проверки их активности.

Из-за гетерогенности, которую мы наблюдали в паттернах экспрессии генов в опухолях ACC, мы применили неконтролируемую иерархическую кластеризацию к результатам RNA-seq из нашей когорты из 68 образцов ACC и неожиданно идентифицировали подгруппу опухолей со значительно худшей общей выживаемостью (рис. ). Из 68 обследованных нами пациентов 25 были не в состоянии выжить в течение 10 лет, и более половины из них относились к подгруппе с плохой выживаемостью, определенной с помощью иерархической кластеризации. Группа с низкой выживаемостью сверхэкспрессировала ERBB3 и недостаточно экспрессировала EGFR , предполагая, что плохая выживаемость может быть связана с переходом от эпителия к мезенхиме или с миоэпителиальным фенотипом против эпителиального.Образцы с плохой выживаемостью также сверхэкспрессировали CTNNB1 и SOX4 и недостаточно экспрессировали PIK3R1 и TP63 , все из которых были связаны с онкогенезом при других формах рака. Мы протестировали 20 различных маркеров, которые, как сообщали другие, могут различать опухоли ACC с низкой выживаемостью, но только три, MYB , PTK2 (Fak) и SNAI2 (Slug), показали значительные различия в нашей когорте ( Таблица 3). Это, вероятно, отражает различия в используемых анализах — уровни РНК в наших анализах по сравнению с иммуногистохимией в большинстве публикаций — но должно поднять предупреждающий сигнал для других, кто желает сравнить опубликованные результаты с исследованиями с использованием различных технологий.

Возможно, наиболее важным открытием этих исследований является использование РНК-seq и паттернов экспрессии генов для выявления подгруппы пациентов с ОКС с высоким риском и низкой выживаемостью, которые ранее не были идентифицированы. Эти пациенты могут получить наибольшую пользу от усиленного наблюдения и разработки новых типов терапевтических стратегий, таких как таргетная терапия, инактивирующая онкоген MYB [46, 47]. Разработка улучшенных биомаркеров для выявления пациентов из группы высокого риска может привести к важным улучшениям в лечении опухолей ACC.

МЕТОДЫ

Образцы ACC FFPE слюнной железы человека

Образцы опухоли неидентифицированной аденоидной кистозной карциномы слюнной железы FFPE были получены из биорепозитория опухоли слюнной железы (Центр рака Андерсона, Хьюстон, Техас, США; Таблица 1). Поиск в банке опухолей головы и шеи доктора медицины Андерсона на предмет аденоидно-кистозной карциномы слюнной железы привел к идентификации 100 пациентов с первичным отделением в нашем учреждении. Были извлечены слайды всех опухолей, окрашенные гематоксилином и эозином, и они подверглись независимому слепому анализу двумя специализированными патологами головы и шеи.Фенотипическая оценка ACC была строго сделана на основе гистопатологического обнаружения паттернов канальцев и решетчатых форм с двойным клеточным образованием и секрецией светлого просвета полисахарида с твердым компонентом и без него. Опухоли твердой формы без тубулярных / решетчатых очагов не включались. Обзор подтвердил диагноз АКК во всех опухолях. Из-за длительного течения опухоли ACC были отобраны образцы с последующим наблюдением не менее 5 лет. Все образцы были собраны с информированного согласия доноров, а исследования проводились в соответствии с принципом Хельсинкской декларации.Все исследования проводились с протоколами, утвержденными Наблюдательным советом учреждения.

Выделение и секвенирование РНК

Общую РНК выделяли из одного или двух 5-микронных срезов FFPE, закрепленных на предметных стеклах, с использованием набора RNeasy FFPE (Qiagen). Синтез кДНК и подготовка библиотеки выполнялись с использованием универсального набора РНК с низким входом SMARTer для секвенирования (Clontech) и набора библиотеки фрагментов Ion Plus (Life Technologies), как описано ранее [17]. Секвенирование выполняли с использованием систем Ion Proton и Ion S5 / XL (Life Technologies) в Общем ресурсе аналитической и трансляционной геномики Университета Нью-Мексико.Данные о секвенировании РНК доступны для загрузки из базы данных NCBI BioProject с использованием регистрационного номера исследования PRJNA287156.

Анализ данных

Низкокачественные и нечеловеческие чтения РНК-seq были идентифицированы и удалены из конвейера анализа с использованием набора инструментов контроля качества Kraken [48, 49]. Высококачественные, обрезанные, считывания РНК-seq человека были сопоставлены с геномом человека (GRCh47; hg19) с использованием TMAP (v5.0.7), и подсчет генов был рассчитан с использованием HT-Seq, как описано ранее [17].Образцы низкого качества, определяемые как образцы, которые имели менее 10% от среднего числа считываний всех образцов, были исключены из дальнейших анализов. Несколько дополнительных образцов были удалены на основании мер контроля качества, описанных в тексте. Обнаружение пиков для идентификации образцов, экспрессирующих MYB или MYBL1 , было выполнено с использованием findpeaks из пакета HOMER (v4.9) [50] с настройками -region, -size 1000 и -minDist 10000.

Unsupervised иерархическая кластеризация

Анализы были ограничены генами, которые были высоко экспрессированы выше порогового уровня в ряде образцов (например,грамм. 250 считываний как минимум в 10 образцах). Иерархическая кластеризация выполнялась на матрице экспрессии из 882 высокоэкспрессированных генов в 68 опухолях ACC с евклидовым расстоянием в качестве меры несходства и методом «полной» кластеризации по умолчанию из команды hclust в пакете stats , части статистического программного обеспечения R / Bioconductor [51]. Гены, которые коррелируют с молекулярной подгруппой, были обнаружены с использованием пакета samr R [52, 53] для идентификации генов, положительно и отрицательно коррелированных с первым и вторым измерениями графика PCA, описывающего эти данные [54].

Статистический анализ

Первичной конечной точкой результата была общая выживаемость (ОВ), определяемая как время от даты постановки диагноза до даты смерти. Субъекты, которые были потеряны для последующего наблюдения или живы в течение периода наблюдения, подвергались цензуре на дату последнего контакта. ОС оценивалась с использованием метода Каплана-Мейера, а различия в ОС были исследованы с помощью лог-рангового теста. Одномерная регрессия Кокса использовалась для оценки ассоциаций клинических характеристик или геномных особенностей с результатом выживания, а многомерная регрессия Кокса использовалась для сравнения этих переменных.Все статистические анализы были выполнены с использованием статистической программы R (54).

Подтверждение транслокации

Для обнаружения предполагаемых слияний образцы с очевидными транслокациями MYB или MYBL1 , о чем свидетельствует отсутствие считываний, сопоставленных с 3′-концом гена, были исследованы на предмет химерных считываний, содержащих последовательность, совпадающую с . MYB или ген MYBL1 и другой ген. Химерные чтения были обнаружены с помощью Integrative Genomics Viewer (версия 2.3.79) [55, 56] с включенным «показом мягких клипов», а затем вторично выровнен по GRCh47 / hg19 с использованием BLAT в браузере генома UCSC [57, 58] для определения партнера по транслокации. Образцы, которые имели очевидные усечения, но для которых не было идентифицировано химерных прочтений, были отнесены к категории «неизвестных». Новые транслокации были подтверждены с помощью ОТ-ПЦР-амплификации РНК, выделенной из срезов FFPE, как описано ранее [17]. Ген-специфические праймеры, используемые для амплификации кДНК, и полученные последовательности Сэнгера представлены в дополнительной таблице 1.

Фрагменты промоторов EN1 и SOX4

Фрагменты промоторов генов EN1 и SOX4 человека выделяли с помощью ПЦР-амплификации из геномной ДНК и клонировали в основную репортерную цепь pGL3. Фрагмент промотора EN1 размером 345 п.н. амплифицировали (прямой: 5′-GAGGAGGAGCTCGAGAACGT AAACTGTCGACGC, обратный: 5′-GAGGAGGAGAAGCTTAGAGAAATGCAGGATTATGGGTC) и клонировали с использованием сайтов рестрикции XhoI и HindIII, включенных в праймеры. Аналогичным образом амплифицировали фрагмент промотора SOX4 размером 161 п.н. (прямой: 5′-GAGGAGGAGGC TAGCTGCAGCCAAGACTGTGAAAG, обратный: 5′-GAGGAGGAGCTCGAGAGGAGTTCCTCCAGTGCAGA) и клонировали с использованием сайтов рестрикции XhoI и NheI.Последовательности вставки проверяли с помощью обычного секвенирования (по Сэнгеру).

Последовательности вставок были проверены с помощью обычного секвенирования (по Сэнгеру). Подчеркнутые части — это непереведенные регионы. Предполагаемые связывающие мотивы Myb выделены жирным шрифтом + подчеркнуты. Показаны геномные координаты (hg19) вставок. Клонированный нами фрагмент промотора EN1 содержит общий полиморфизм (rs3731613) по сравнению с эталонной последовательностью hg19, обозначенной строчной буквой «g».

> SOX4-Luc CHR6: 215

-215

GCTGCAGCCAAGACTGTGAAAGGATAAAGAGGCGCGAGGCGGA ATTGGGGTCTGCTCTAAGCTG
CAGCAAGAG AAACTGTGTGT GAGGGGAAGAGGCCTGTTTCGCTGTCGGGTCTCTAGTTCTTGCA
CGCTCTTTAAGAGTCTGCACTGGAGGAACTCCT

> EN1-Luc ChR2: 119605727-119606071


AACGTAAACGTGCGACGCTAGCTAGGCGCAGCGGGCCTTTCAGATTTTGCTATTTGTGAAAAACAA ATTGCGCCTCTGAAAGTAACCAACTCTAGGTCTATTTCACATCACCGACCTCCCTGTCTCACTCCCC
CTCCCTCCACTACACACACCCAAACCCACACCCACCCACAAACACAC AAACCGGCAG
TGACAACAA CCACCCATCCTTCAATAACAGCAACCAGAGACAGAGGAGAAAATAAAAAGCTGAGTTTCTTAGGCGT
GGGGGTGCAAAACAGCCAGGCTCCTGCCTACTGCCCCTGCTCCCGg
AGCTCACAGACCCATAATC CTGCATTTCTCTAA

Трансфекция и гена-репортера анализы

Myb и MYBL1 экспрессии слитого векторы, клонировали в pcDNA3, были описаны ранее [17].В частности, слияние c-Myb: NFIB содержит фрагмент кДНК, охватывающий экзоны 1-8 [59, 60] MYB (NM_001130173), кодирующий первые 313 аминокислотных остатков c-Myb, слитых с экзонами 10-11 из NFIB (NM_001282787). ), который добавляет 73 новых аминокислотных остатка к усеченному белку Myb. Слияние A-Myb: RAD51B содержит экзоны 1–9 из MYBL1 (NM_001080416), кодирующие первые 367 аминокислотных остатков A-Myb, слитых с интронной областью RAD51B , которая добавляет 28 новых аминокислот к усеченному A-Myb. белок.Анализы репортерного гена проводили в клетках HEK293T в трех повторностях. Клетки высевали примерно от 4 до 6 × 10 4 клеток на лунку в 24-луночный планшет и оставляли 24 часа для роста перед временной котрансфекцией 50 нг репортерной плазмиды люциферазы (EN1-luc или SOX4-luc в pGL3-basic ) и 5 ​​нг активаторной плазмиды ( MYB или слитых MYBL1 , клонированных в pCDNA3). Трансфекции выполняли в двух экземплярах с использованием реагента для трансфекции TransIT-2020 (Mirus) в соответствии с инструкциями производителя.Клетки собирали и люминесценцию измеряли через 48 часов с использованием системы анализа люциферазы (Promega). Данные за вычетом фона нормализовали для клеток, трансфицированных репортерной плазмидой без активатора (пустая pCDNA3). Все эксперименты проводились как минимум в трех экземплярах.

Вклад авторов

CAF, KJB и BMP выполнили экспериментальную работу и проанализировали данные. HK провел статистический анализ. YM и AKE-N собрали и предоставили образцы пациентов. Компания SAN руководила исследованием и проводила биоинформатический анализ.CAF и SAN написали статью. Все авторы рецензировали рукопись перед публикацией.

БЛАГОДАРНОСТИ

Авторы выражают признательность Дженнифер Вудс, Мэгги Сайфери, Джейми Падилле, Джейсону Байарсу и Гэвину Пикетту за выдающуюся техническую поддержку. В некоторых экспериментах использовались средства или услуги, предоставляемые общим ресурсом аналитической и трансляционной геномики, общим ресурсом флуоресцентной микроскопии и визуализации клеток и общим ресурсом репозитория тканей человека и анализа клеток, которые поддерживаются штатом Нью-Мексико и UNM Comprehensive Cancer Центр P30CA118100.Мы также благодарны за поддержку Фонду исследований аденоидной кистозной карциномы и Биорепозиторию опухолей слюнных желез. Мы особенно благодарим доктора Дайану Белл за помощь с подтверждением опухоли ACC. Данные о секвенировании РНК доступны для загрузки из базы данных NCBI BioProject с использованием регистрационного номера исследования PRJNA287156.

КОНФЛИКТЫ ИНТЕРЕСОВ

Нет потенциального конфликта интересов для любого автора.

ФИНАНСИРОВАНИЕ

NIH предоставляет гранты 5R01CA170250, 5R01DE023222 и P30CA118100.

ССЫЛКИ

1. Митани Ю., Рао PH, Futreal PA, Робертс Д. Б., Стивенс П. Дж., Чжао Ю. Дж., Чжан Л., Митани М., Вебер Р. С., Липпман С. М., Цаулин С., Эль-Наггар А. К.. Новые хромосомные перестройки и точки разрыва в точке t (6; 9) в аденоидно-кистозной карциноме слюны: связь с химерным слиянием MYB-NFIB, экспрессией MYB и клиническим исходом. Clin Cancer Res. 2011; 17: 7003–14. https://doi.org/10.1158/1078-0432.CCR-11-1870.

2. Хант JL. Актуальная информация о молекулярной диагностике плоскоклеточных опухолей и опухолей слюнных желез головы и шеи.Arch Pathol Lab Med. 2011; 135: 602–09.

3. Белл Д., Робертс Д., Кис М., Рао П., Вебер Р.С., Эль-Наггар А.К. Зависимая от типа клеток экспрессия биомаркера при аденоидно-кистозной карциноме: биологические и терапевтические последствия. Рак. 2010; 116: 5749–56. https://doi.org/10.1002/cncr.25541.

4. Диллон П.М., Чакраборти С., Москалюк, Калифорния, Джоши П.Дж., Томас С.Ю. Аденоидно-кистозная карцинома: обзор последних достижений, молекулярных мишеней и клинических испытаний. Голова Шея. 2016; 38: 620–7. https://doi.org/10.1002 / хед.23925.

5. Перссон М., Андрен Ю., Марк Дж., Хорлингс Х. М., Перссон Ф., Стенман Г. Рекуррентное слияние генов факторов транскрипции MYB и NFIB при карциномах груди, головы и шеи. Proc Natl Acad Sci USA. 2009; 106: 18740–4. https://doi.org/10.1073/pnas.04106.

6. Митани Ю., Ли Дж., Рао П. Х., Чжао Ю. Дж., Белл Д., Липпман С. М., Вебер Р. С., Цулин С., Эль-Наггар А. К.. Всесторонний анализ слияния генов MYB-NFIB при аденоидно-кистозной карциноме слюны: частота, вариабельность и клинико-патологическое значение.Clin Cancer Res. 2010; 16: 4722–31. https://doi.org/10.1158/1078-0432.CCR-10-0463.

7. Западный РБ, Конг К., Кларк Н., Гилкс Т., Липсик Дж.С., Цао Х., Квок С., Монтгомери К.Д., Варма С., Ле QT. Экспрессия и транслокация MYB в аденоидно-кистозных карциномах и других опухолях слюнных желез с клинико-патологической корреляцией. Am J Surg Pathol. 2010; 35: 92–9. https://doi.org/10.1097/PAS.0b013e3182002777.

8. Рамзи Р.Г., Гонда Т.Дж. MYB функционирует в нормальных и раковых клетках. Nat Rev Рак. 2008; 8: 523–34.https://doi.org/10.1038/nrc2439.

9. Zhou Y, Ness SA. Белки Myb: ангелы и демоны в нормальных и трансформированных клетках. Front Biosci (Landmark Ed). 2011; 16: 1109–31.

10. Джордж О.Л., Несс С.А. Ситуационная осведомленность: регуляция фактора транскрипции myb в дифференцировке, клеточном цикле и онкогенезе. Раки (Базель). 2014; 6: 2049–71. https://doi.org/10.3390/cancers6042049.

11. Дриер Й, Коттон М.Дж., Уильямсон К.Э., Гиллеспи С.М., Райан Р.Дж., Клюк М.Дж., Кэри С.Д., Родиг С.Дж., Шолл Л.М., Афрохех А.Х., Факин В.С., Кеймадо Л., Ци Дж. И др.Онкогенная петля обратной связи MYB управляет альтернативными клеточными судьбами при аденоидно-кистозной карциноме. Нат Жене. 2016; 48: 265–72. https://doi.org/10.1038/ng.3502.

12. Brill LB 2nd, Kanner WA, Fehr A, Andrén Y, Moskaluk CA, Löning T, Stenman G, Frierson HF Jr. Анализ экспрессии MYB и слияния генов MYB-NFIB при аденоидной кистозной карциноме и других новообразованиях слюнных желез. Мод Pathol. 2011; 24: 1169–76.

13. Фер А., Ковач А., Лонинг Т., Фриерсон Х. мл., Ван ден Оорд Дж., Стенман Г. Слияние генов MYB-NFIB — новая генетическая связь между аденоидной кистозной карциномой и дермальной цилиндромой.J Pathol. 2011; 224: 322–7. https://doi.org/10.1002/path.2909.

14. Persson M, Andrén Y, Moskaluk CA, Frierson HF Jr, Cooke SL, Futreal PA, Kling T, Nelander S, Nordkvist A, Persson F, Stenman G. Клинически значимые изменения числа копий и сложные перестройки MYB и NFIB при аденоидно-кистозной карциноме головы и шеи. Гены Хромосомы Рак. 2012; 51: 805–17. https://doi.org/10.1002/gcc.21965.

15. Пуштасери М.П., ​​Садоу П.М., Ушику А., Бординьон П., Макки Т.А., Факен В.С..Иммуноокрашивание MYB является полезным вспомогательным тестом для отличия аденоидно-кистозной карциномы от плеоморфной аденомы в образцах тонкоигольной аспирационной биопсии. Cancer Cytopathol. 2014; 122: 257–65.

16. D’Alfonso TM, Mosquera JM, MacDonald TY, Padilla J, Liu YF, Rubin MA, Shin SJ. Слияние генов MYB-NFIB при аденоидно-кистозной карциноме молочной железы с уделением особого внимания солидному варианту с базалоидными признаками. Hum Pathol. 2014; 45: 2270–80. https://doi.org/10.1016/j.humpath.2014.07.013.

17. Brayer KJ, Frerich CA, Kang H, Ness SA. Рецидивирующие слияния MYB и MYBL1 определяют общий онкогенный путь, управляемый факторами транскрипции, в аденоидной кистозной карциноме слюнных желез. Рак Discov. 2016; 6: 176–87. https://doi.org/10.1158/2159-8290.CD-15-0859.

18. Белл Д., Белл А.Х., Бондарук Дж., Ханна Е.Ю., Вебер Р.С. Углубленная характеристика транскриптома аденоидной кистозной карциномы слюнной железы с акцентом на доминантный тип клеток. Рак. 2016; 122: 1513–22. https: // doi.org / 10.1002 / cncr.29959.

19. Белл Д., Белл А.Х., Бондарук Дж., Ханна Е.Ю., Вебер Р.С. Приложение к статье Белла и др. «Углубленная характеристика транскриптома аденоидной кистозной карциномы слюны с акцентом на доминантном типе клеток». Рак. 2016; 122: 2278–9. https://doi.org/10.1002/cncr.30061.

20. Rettig EM, Talbot CC Jr, Sausen M, Jones S, Bishop JA, Wood LD, Tokheim C, Niknafs N, Karchin R, Fertig EJ, Wheelan SJ, Marchionni L, Considine M, et al. Полногеномное секвенирование аденоидной кистозной карциномы слюнных желез.Рак Prev Res (Phila). 2016; 9: 265–74. https://doi.org/10.1158/1940-6207.CAPR-15-0316.

21. Митани Ю., Лю Б., Рао П.Х., Борра В.Дж., Заферео М., Вебер Р.С., Кис М., Лозано Дж., Футреал ПА, Цулин С., Эль-Наггар А.К. Новые реаранжировки гена MYBL1 с рецидивирующими слияниями MYBL1-NFIB в аденоидных кистозных карциномах слюнных желез без транслокаций t (6; 9). Clin Cancer Res. 2016; 22: 725–33. https://doi.org/10.1158/1078-0432.CCR-15-2867-T.

22. Ферраротто Р., Митани Ю., Диао Л., Гихарро И., Ван Дж., Цвейдлер-Маккей П., Белл Д., Уильям В. Н. мл., Глиссон Б. С., Вик М. Дж., Капун А. М., Патнаик А., Экхардт Г. и др.Активация мутаций NOTCh2 определяет особую подгруппу пациентов с аденоидно-кистозной карциномой, у которых плохой прогноз, предрасположенность к метастазам в кости и печень и потенциальная реакция на ингибиторы Notch2. J Clin Oncol. 2017; 35: 352–60. https://doi.org/10.1200/JCO.2016.67.5264.

23. Phuchareon J, Ohta Y, Woo JM, Eisele DW, Tetsu O. Генетическое профилирование выявляет перекрестное заражение и неправильную идентификацию 6 клеточных линий аденоидной кистозной карциномы: ACC2, ACC3, ACCM, ACCNS, ACCS и CAC2.PLoS One. 2009; 4: e6040. https://doi.org/10.1371/journal.pone.0006040.

24. Чжао М., Сано Д., Пикеринг К.Р., Джассер С.А., Хендерсон Ю.С., Клейман Г.Л., Стерджис Е.М., Оу Т.Дж., Лотан Р., Кэри Т.Е., Сакс П.Г., Грандис Дж. Р., Сидранский Д. и др. Сборка и начальная характеристика панели из 85 проверенных геномом клеточных линий из различных участков опухоли головы и шеи. Clin Cancer Res. 2011; 17: 7248–64. https://doi.org/10.1158/1078-0432.CCR-11-0690.

25. Браун РБ, Мадрид, штат Нью-Джерси, Сузуки Н, Несс С.А.Оптимизированный подход к секвенированию РНК Ion Proton раскрывает детали сплайсинга РНК и особенности редактирования транскриптома. PLoS One. 2017; 12: e0176675. https://doi.org/10.1371/journal.pone.0176675.

26. Gambaro K, Quinn MC, Wojnarowicz PM, Arcand SL, de Ladurantaye M, Barres V, Ripeau JS, Killary AM, Davis EC, Lavoie J, Provencher DM, Mes-Masson AM, Chevrette M, et al. Экспрессия VGLL3 связана с фенотипом опухолевого супрессора при эпителиальном раке яичников. Мол Онкол. 2013; 7: 513–30.https://doi.org/10.1016/j.molonc.2012.12.006.

27. Tufegdzic Vidakovic A, Rueda OM, Vervoort SJ, Sati Batra A, Goldgraben MA, Uribe-Lewis S, Greenwood W., Coffer PJ, Bruna A, Caldas C. Контекстно-зависимые эффекты TGF-бета / SMAD3 при раке Модулируются эпигеномом. Отчеты по ячейкам. 2015; 13: 2480–90. https://doi.org/10.1016/j.celrep.2015.11.040.

28. Добин А., Дэвис К.А., Шлезингер Ф., Дренкоу Дж., Залески С., Джа С., Батут П., Чейссон М., Джингерас Т.Р. STAR: сверхбыстрый универсальный выравниватель RNA-seq.Биоинформатика. 2013; 29: 15–21. https://doi.org/10.1093/bioinformatics/bts635.

29. Лей В., Раштон Дж. Дж., Дэвис Л. М., Лю Ф., Несс С.А. Положительные и отрицательные детерминанты специфичности целевого гена в факторах транскрипции Myb. J Biol Chem. 2004; 279: 29519–27.

30. Белл Д., Белл А., Робертс Д., Вебер Р.С., Эль-Наггар А.К. Фактор транскрипции развития EN1 — новый биомаркер аденоидной кистозной карциномы слюнных желез человека. Рак. 2012; 118: 1288–92.

31. Фриерсон Х. Ф. младший, Эль-Наггар А. К., Уэлш Дж. Б., Сапиносо Л. М., Су А. И., Ченг Дж., Саку Т., Москалук К.А., Хэмптон Г.М.Крупномасштабный молекулярный анализ выявляет гены с измененной экспрессией при аденоидно-кистозной карциноме слюнной железы. Am J Pathol. 2002; 161: 1315–23. https://doi.org/10.1016/S0002-9440(10)64408-2.

32. Несс С.А., Ковенц-Лейтц Э., Казини Т., Граф Т., Лейтц А. Myb и NF-M: комбинаторные активаторы миелоидных генов в гетерологичных типах клеток. Genes Dev. 1993; 7: 749–59.

33. Несс С.А., Маркнелл А., Граф Т. Продукт онкогена v-myb связывается с промиелоцит-специфическим геном mim-1 и активирует его.Клетка. 1989; 59: 1115–25.

34. Йи Ц., Ли ББ, Чжоу С.Х. Экспрессия Bmi-1 предсказывает прогноз при аденоидно-кистозной карциноме слюны и коррелирует с факторами, связанными с эпителиально-мезенхимальным переходом. Ann Diagn Pathol. 2016; 22: 38–44. https://doi.org/10.1016/j.anndiagpath.2015.10.015.

35. Чжоу Ц., Лю Дж, Тан Й, Чжу Дж, Чжэн М., Цзян Дж, Ян Дж, Лян Х. Коэкспрессия индуцируемого гипоксией фактора-2альфа, TWIST2 и SIP1 может коррелировать с инвазией и метастазированием аденоида слюнной железы. кистозная карцинома.J Oral Pathol Med. 2012; 41: 424–31. https://doi.org/10.1111/j.1600-0714.2011.01114.x.

36. Liu H, Du L, Wang R, Wei C, Liu B, Zhu L, Liu P, Liu Q, Li J, Lu SL, Xiao J. Высокая частота потери экспрессии PTEN при аденоидной кисте твердой слюнной железы человека карцинома и ее значение для таргетной терапии. Oncotarget. 2015; 6: 11477–91. https://doi.org/10.18632/oncotarget.3411.

37. Phuchareon J, van Zante A, Overdevest JB, McCormick F, Eisele DW, Tetsu O. Экспрессия c-Kit ограничивает скорость прогрессирования опосредованного факторами стволовых клеток заболевания при аденоидной кистозной карциноме слюнных желез.Перевод Онкол. 2014; 7: 537–45. https://doi.org/10.1016/j.tranon.2014.07.006.

38. Су БХ, Цюй Дж., Сонг М., Хуанг XY, Ху ХМ, Се Дж., Чжао Ю., Дин Л.К., Ше Л., Чен Дж., Лин Л.С., Линь X, Чжэн Д.Л. и др. Передача сигналов NOTCh2 способствует росту клеток, противодействию апоптозу и метастазированию в аденоидно-кистозной карциноме слюны. Oncotarget. 2014; 5: 6885–95. https://doi.org/10.18632/oncotarget.2321.

39. Qi C, Shao Y, Li N, Zhang C, Zhao M, Gao F. Прогностическое значение экспрессии PDCD4 в аденоидной кистозной карциноме слюнной железы человека.Med Oncol. 2013; 30: 491. https://doi.org/10.1007/s12032-013-0491-1.

40. Чжу X, Сюй Дж. Дж., Ху С. С., Фэн Дж. Г., Цзян Л. Х., Хоу ХХ, Цао Дж., Хань Дж., Лин З. К., Ге М. Х. Pim-1 действует как онкоген при аденоидно-кистозной карциноме слюнных желез человека. J Exp Clin Cancer Res. 2014; 33: 114. https://doi.org/10.1186/s13046-014-0114-5.

41. Тан Й.Л., Лю Х, Гао С.Ю., Фэн Х., Цзян Ю.П., Ван С.С., Ян Дж., Цзян Дж., Ма Х.Р., Тан Й.Дж., Чен И, Лян Х.С. WIP1 стимулирует миграцию и инвазию аденоидной кистозной карциномы слюны, индуцируя MMP-9 и VEGF-C.Oncotarget. 2015; 6: 9031–44. https://doi.org/10.18632/oncotarget.3320.

42. Чанг Б., Ян Х, Цзяо Ю., Ван К., Лю З., Ву П, Ли С., Ван А. Дерегуляция SOD2 усиливает миграцию, инвазию и имеет плохой прогноз при аденоидно-кистозной карциноме слюнной железы. Sci Rep.2016; 6: 25918. https://doi.org/10.1038/srep25918.

43. Dai W, Tan X, Sun C, Zhou Q. Высокая экспрессия SOX2 связана с плохим прогнозом у пациентов с аденоидно-кистозной карциномой слюнных желез. Int J Mol Sci. 2014; 15: 8393–406.https://doi.org/10.3390/ijms15058393.

44. Субраманиан А., Тамайо П., Мутха В.К., Мукерджи С., Эберт Б.Л., Джиллетт М.А., Паулович А., Померой С.Л., Голуб Т.Р., Ландер Е.С., Месиров Дж.П. Анализ обогащения набора генов: основанный на знаниях подход к интерпретации профилей экспрессии в масштабе всего генома. Proc Natl Acad Sci USA. 2005; 102: 15545–50. https://doi.org/10.1073/pnas.0506580102.

45. Бен-Порат И., Томсон М.В., Кэри В.Дж., Дж. Р., Белл Г. В., Регев А., Вайнберг Р. А.. Сигнатура экспрессии гена, подобная эмбриональным стволовым клеткам, в плохо дифференцированных агрессивных опухолях человека.Нат Жене. 2008; 40: 499–507. https://doi.org/10.1038/ng.127.

46. Уттаркар С., Пионтек Т., Дукаре С., Шомбург С., Шленке П., Бердел В.Е., Мюллер-Тидоу С., Шмидт Т.Дж., Клемпнауэр К.Х. Нарушение взаимодействия малых молекул Myb / p300 нацелено на клетки острого миелоидного лейкоза. Mol Cancer Ther. 2016; 15: 2905–2915.

47. Уттаркар С., Дассе Е., Кулибали А., Штейнманн С., Якобс А., Шомбург С., Трентманн А., Хосе Дж., Шленке П., Бердел В.Е., Шмидт Т.Дж., Мюллер-Тидоу С., Фрэмптон Дж. И др. Нацеливание на острый миелоидный лейкоз с помощью низкомолекулярного ингибитора взаимодействия Myb / p300.Кровь. 2016; 127: 1173–82. https://doi.org/10.1182/blood-2015-09-668632.

48. Депутат Дэвиса, ван Донген С., Абреу-Гуджер С., Бартоничек Н., Энрайт А.Дж. Kraken: набор инструментов для контроля качества и анализа данных последовательности с высокой пропускной способностью. Методы. 2013; 63: 41–9. https://doi.org/10.1016/j.ymeth.2013.06.027.

49. Wood DE, Salzberg SL. Kraken: сверхбыстрая классификация метагеномных последовательностей с использованием точного выравнивания. Genome Biol. 2014; 15: R46. https://doi.org/10.1186/gb-2014-15-3-r46.

50. Хайнц С., Беннер С., Спанн Н., Бертолино Е., Лин Ю.С., Ласло П., Ченг Дж. Х., Мюрре С., Сингх Х., Гласс С. К.. Простые комбинации факторов транскрипции, определяющих клонирование, активируют цис-регуляторные элементы, необходимые для идентичности макрофагов и В-клеток. Mol Cell. 2010; 38: 576–89. https://doi.org/10.1016/j.molcel.2010.05.004.

51. Джентльмен Р.С., Кэри В.Дж., Бейтс Д.М., Болстад Б., Деттлинг М., Дудуа С., Эллис Б., Готье Л., Дж. Й., Джентри Дж., Хорник К., Хотхорн Т., Хубер В. и др. Биокондуктор: разработка открытого программного обеспечения для вычислительной биологии и биоинформатики.Genome Biol. 2004; 5: R80.

52. Ли Дж., Тибширани Р. Поиск согласованных закономерностей: непараметрический подход для определения дифференциальной экспрессии в данных RNA-Seq. Stat Methods Med Res. 2013; 22: 519–36. https://doi.org/10.1177/0962280211428386.

53. Ли Дж., Виттен Д.М., Джонстон И.М., Тибширани Р. Нормализация, тестирование и оценка вероятности ложного обнаружения для данных секвенирования РНК. Биостатистика. 2012; 13: 523–38. https://doi.org/10.1093/biostatistics/kxr031.

54. Тушер В.Г., Тибширани Р., Чу Г.Анализ значимости микрочипов применительно к отклику на ионизирующее излучение. Proc Natl Acad Sci USA. 2001; 98: 5116–21.

55. Робинсон Дж. Т., Торвальдсдоттир Х., Винклер В., Гутман М., Лендер Е. С., Гетц Г., Месиров Дж. П.. Программа просмотра интегративной геномики. Nat Biotechnol. 2011; 29: 24–6. https://doi.org/10.1038/nbt.1754.

56. Thorvaldsdottir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): высокопроизводительная визуализация и исследование данных геномики. Краткий биоинформ. 2013; 14: 178–92.https://doi.org/10.1093/bib/bbs017.

57. Карольчик Д., Хинрихс А.С., Кент В.Дж. Браузер генома UCSC. Curr Protoc Bioinformatics. 2007 Март; Глава 1: Раздел 1.4. https://doi.org/10.1002/0471250953.bi0104s17.

58. Кент В.Дж., Сугнет К.В., Фьюри Т.С., Роскин К.М., Прингл Т.Х., Захлер А.М., Хаусслер Д. Браузер генома человека в UCSC. Genome Res. 2002; 12: 996–1006. https://doi.org/10.1101/gr.229102.

59. O’Rourke JP, Ness SA. Альтернативный сплайсинг РНК дает множество форм c-Myb с уникальной транскрипционной активностью.Mol Cell Biol. 2008; 28: 2091–101. https://doi.org/10.1128/MCB.01870-07.

60. Чжоу Ю.Е., О’Рурк Дж. П., Эдвардс Дж. С., Несс С.А. Одномолекулярный анализ альтернативного сплайсинга c-myb выявил новые классификаторы для предшественника B-ALL. PLoS One. 2011; 6: e22880.

61. Phuchareon J, Overdevest JB, McCormick F, Eisele DW, van Zante A, Tetsu O. Связывающий жирную кислоту белок 7 является молекулярным маркером аденоидной кистозной карциномы слюнных желез: последствия для клинической значимости. Перевод Онкол.2014; 7: 780–7. https://doi.org/10.1016/j.tranon.2014.10.003.

(PDF) Тяжелый эктопический синдром Кушинга, вызванный аденоидной кистозной карциномой слюнной железы

4 Секреция АКТГ карциномой языка, Endocr Pract. 2013; 19 (№ 5)

карциноид, но также в ШАЛ неизвестного происхождения (12,15,16).

В качестве альтернативного подхода митотан, адренолитический агент,

, может быть эффективным для достижения химической адреналэктомии;

, однако, его использование ограничено из-за возникновения значительных побочных эффектов

, особенно желудочно-кишечных расстройств (65%)

и неврологических нарушений (26%) (20).

ЗАКЛЮЧЕНИЕ

Здесь мы представляем редкий случай EAS, вызванного сали-

различных желез ACC. Это иллюстрирует проблему, которую это состояние может поставить в отношении диагностики и лечения.

EAS следует заподозрить на основании наличия гипертонии,

гипокалиемического метаболического алкалоза и непереносимости глюкозы

у онкологического пациента. Когда никакое медицинское лечение не является эффективным, следует рассматривать паллиативную двустороннюю адреналэктомию для эффективного восстановления эвкортизолемии (19,21).

СПИСОК ЛИТЕРАТУРЫ

1. Ejas S, Vassilopoulou-Sellin R, Busaidy NL, et al.

Синдром Кушинга, вторичный по отношению к эктопической адренокортикотропии

секреция гормона pic. Рак. 2011; 117: 4381-4389.

2. Бхансали А., Валиа Р., Рана С.С. и др. Внематочный синдром Кушинга

: опыт работы в центре третичной медицинской помощи. Индийский J

Med Res. 2009; 129: 33-41.

3. Сальгадо Л.Р., Вилларес Фрагосо MCB, Кнопфельмахер

M, et al.Синдром эктопического АКТГ: наш опыт с

25 случаями. Eur J Endocrinol. 2006; 155: 725-733.

4. Исидори А.М., Лензи А. Внематочный синдром АКТГ. Arq

Бюстгальтеры Endocrinol Metab. 2007; 51: 1217-1225.

5. Вилар Л., Фрейтас М.С., Фариа М. и др. Подводные камни в диагностике синдрома Кушинга

. Arq Bras Endocrinol

Metab. 2007; 51: 1207-1216.

6. Baas JM, Kapiteijn E, Pereira AM, Nortier JWR.

Атипичный синдром Кушинга, вызванный эктопическим АКТГ

секреция аденокарциномы пищевода.Neth J Med.

2010; 68: 265-267.

7. Хоулетт Т.А., Друри П.Л., Перри Л. и др.

Диагностика и лечение АКТГ-зависимого синдрома Кушинга:

сравнение характеристик эктопического и гипофизарного производства АКТГ

. Клин Эндокринол (Oxf). 1986; 24: 699-713.

8. Торпи Д. Д., Маллен Н., Илиас И. и др. Связь гипер-

напряжения и гипокалиемии с синдромом Кушинга вызывала

эктопической секрецией АКТГ.Серия из 58 дел. Ann NY

Acad Sci. 2002; 970: 134-144.

9. Стюарт П.М., Уокер В.Р., Холдер Г. и др. 11-бета-гидро-

Активность ксистероиддегидрогеназы при синдроме Кушинга:

, объясняющая состояние избытка минералокортикоидов при синдроме экто-

pic адренокортикотропина. J Clin Endocrinol

Metab. 1995; 80: 3617-3620.

10. Пивонелло Р., Фероне Д., Ламбертс С.В.Дж. и др. Каберголин

плюс ланреотид при эктопическом синдроме Кушинга.N Engl J

Med. 2005; 352: 2457-2458.

11. Пивонелло Р., Фероне Д., Де Хердер В.В. и др. Экспрессия и функция рецептора дофамина

в кортикотрофных эктопических опухолях

. J Clin Endocrinol Metab. 2007; 92: 65-69.

12. Бруно О.Д., Данилович К., Манавела М. и др. Долгосрочное лечение октреотида или каберголина при гиперсекреции кортикотропина

pic: клинический случай и обзор литературы

. Endocr Pract. 2010; 16: 829-834.

13. Резник М., Мелон Дж., Ламбрихт М. и др. Нейроэндокринная

опухоль полости носа (эстезионейробластома).

По поводу случая паранеопластического синдрома Кушинга

. Энн Патол. 1987; 7: 137-142.

14. Саид-аль-Наиф Н, Ссиандра К., Гнепп DR. Умеренно

дифференцированная нейроэндокринная карцинома (атипичный рак —

ноид) околоушной железы: отчет о трех случаях с кон-

временного обзора нейроэндокринных карцином слюнных желез.

Голова Шея Патол. 2013 2 марта [Epub перед печатью].

15. Сугавара М., Хаген Г.А. Синдром эктопического АКТГ, вызванный

аденоидно-кистозной карциномой слюнных желез. Ответ на

метирапон. Arch Intern Med. 1977; 137: 102-105.

16. Саутгейт HJ, Archbold GPR, El-Sayed ME, Wright

J, Marks V. Внематочное высвобождение GHRH и ACTH из

Аденоидно-кистозная карцинома, приводящая к акромегалии и

, осложненная инфарктом гипофиза.Postgrad Med J.

1988; 64: 145-148.

17. Манчини Т., Порчелли Т., Джустина А. Лечение болезни Кушинга

: обзор и недавние открытия. Ther Clin Risk

Manag. 2010; 6: 505-515.

18. Биллер БМК, Гроссман А.Б., Стюарт П.М. Лечение

адренокортикотропин-зависимого синдрома Кушинга: согласованное утверждение

. J Clin Endocrinol Metab. 2008; 93:

2454-2462.

19. Хан JY, Mirsadraei L, Yeh MW, et al.Двусторонняя адре-

нэктомия: процедура спасения жизни при тяжелом синдроме Кушинга

. Endocr Pract. 2012; 20: 1-17.

20. Донадилль Б., Груссен Л., Уэйнтроп С. и др. Лечение

синдрома Кушинга, вызванного эктопическим адренокортикотропином

Секреция с 1, орто-1, пара-дихлор-дифенил-

дихлор-этан: данные у 23 пациентов из одного центра

. J Clin Endocrinol Metab. 2010; 95: 537-544.

21. Lutgers HL, Vergragt J, Dong P, et al.Тяжелая гиперкор-

тизолизм: неотложная медицинская помощь, требующая срочного вмешательства-

ция. Crit Care Med. 2010; 38: 1598-1601.

Клинико-патологические особенности и биомаркеры аденоидно-кистозной карциномы

822009

7200617052584

1.

E ZvrkoM Голубович Аденоид гортани кистозный карцинома Акта Оториноларингол Итал 2

2.

AD LupinettiDB RobertsMD Williams Синоназал аденоидно-кистозная карцинома: M.Онкологический центр Д. Андерсона Опыт Рак11027262731200710.1002 / cncr.2309617960615

3.

Де Крус Перес FR PiresMA LopesOP de AlmeidaLP Kowalski Аденоидно-кистозная карцинома и мукоэпидермоид карцинома гайморовой пазухи: отчет о 44-летнем опыте 25 кейсов от одного учрежденияJ Oral Maxillofac Surg6415

4.

F DongPW GidleyT Ho Аденоидно-кистозный рак наружного слуха каналЛарингоскоп11815

6200810.1097 / MLG.0b013e31817c42a818677277

5.

Дж. Э. ван дер Валаг Бекинг, Сноу И. ван дер Дистантные метастазы аденоидно-кистозного рака слюнной железы железы и значение диагностических обследований во время Голова Шея 24779783200212203804

6.

Д-р Гомес, BS Hoppe, SL Wolden, результаты и прогностические переменные при аденоидно-кистозной карциноме головы и шея: недавний опыт Int J Radiat Oncol Biol Phys7013651372200810.1016 / j.ijrobp.2007.08.00818029108

7.

YH KoMA LeeYS Hong Прогностические факторы влияющие на клинический исход аденоидно-кистозной карциномы голова и шеяJpn J Clin Онкол37805811200710.1093 / jjco / hym11

7012

8.

Джангл ШенгК ВанИ Шуйць ВэйВыражение молекулы адгезии нервных клеток при аденоидной кисте слюны карцинома и ее связь с периневральной инвазией Rep1814131416200717982624

9.

M CampistronI RouquetteF Курбон Аденоид кистозная карцинома легкого: интерес 18FDG ПЭТ / КТ в лечение атипичного предлежания легкого Рак5

36200810.1016 / j.lungcan.2007.06.00217640764

10.

LF LiSH ZhouK Zhao Клиническое значение Однофотонная эмиссионная компьютерная томография с ФДГ: компьютерная томография в диагностике рака головы и шеи и изучении его МеханизмРак Biother Радиофарм237017142008 10.1089 / cbr.2008.0510

11.

IS WoodP Trayhurn Транспортеры глюкозы (GLUT и SGLT): расширенные семейства белков транспорта сахара Br J Nutr893

10.1079 / BJN200276312568659

12.

JK ChungYJ LeeSK KimJM JeongDS LeeMC Ли Сравнение поглощения [18F] фтордезоксиглюкозы с глюкозой экспрессия и скорость пролиферации транспортера-1 в глиоме человека и немелкоклеточный рак легкого Nucl Med Commun 2511172004

13.

SH ZhouJ FanXM ChenKJ ChengSQ Вангу: подавление пролиферации клеток и поглощения глюкозы у человека. клетки карциномы гортани антисмысловыми олигонуклеотидами против транспортер глюкозы-1 Голова шеи 3116241633200910.1002 / hed.21137

14.

SR JacobsCE HermanNJ Maciver Поглощение глюкозы ограничивает активацию Т-клеток и требует опосредованного CD28 Akt-зависимые и независимые пути J Иммунол18044764486200810.4049 / джиммунол.180.7.447618354169

15.

LG Melstrom, MR Salabat, XZ Ding, апигенин. ингибирует переносчик глюкозы GLUT-1 и фосфоинозитид Путь 3-киназы / Akt при раке поджелудочной железы человека клетки поджелудочной железы37426431200810.1097 / MPA.0b013e3181735ccb18953257

16.

Дж. Буссинк, А. Я. ван дер Когель, Дж. Х. Kaanders Активация пути PI3-K / AKT и последствия для Механизмы радиорезистентности при раке головы и шеи Oncol

96200810.1016 / S1470-2045 (08) 70073-118308254

17.

J FangXM LuoHT YaoSH ZhouLX RuanSX YanЭкспрессия переносчика глюкозы-1, индуцируемая гипоксией фактор-1α, фосфатидилинозитол-3-киназа и протеинкиназа B (Akt) в отношении поглощения [(18) F] фтордезоксиглюкозы в носоглотке диффузная В-крупноклеточная лимфома: описание случая и обзор литературы J Int Med Res38216021682010

18.

AM ChenMK BucciV Weinberg Аденоидно-кистозный карцинома головы и шеи, леченная хирургическим путем, с или без послеоперационная лучевая терапия: прогностические особенности РецидивInt J Radiat Oncol Biol Phys6615215

10.1016 / j.ijrobp.2006.04.014160

19.

YH KoSY RohHS WonПрогностическое значение экспрессии ядерного сурвивина при удаленной аденоидной кистозной карциноме головы и шеи Онкол230201010.1186 / 1758-3284-2-3021034499

20.

EP ProkopakisCH SnydermanEY HannaRL CarrauJT JohnsonF D’Amico Факторы риска местного рецидива аденоидно-кистозная карцинома: роль послеоперационной лучевой терапии J Otolarygo120281286199910.1016 / S0196-0709 (99)

-5

21.

ВМ МенденхоллCG МоррисRJ AmdurJW WerningRW HinermanDB Villaret: лучевая терапия отдельно или в сочетании с хирургическим вмешательством аденоидно-кистозный рак головы и шеи Шея 26154162200410.1002 / край.1038014762884

22.

Т.А. ИзелиЛХ Карнелл, С.М. Грэм, Роль лучевая терапия при аденоидно-кистозной карциноме головы и шеи J Ларингол Отол12311371144200910.1017 / S00222151099

19573256

23.

S ZhouS WangQ WuQ Wang Выражение переносчики глюкозы-1 и -3 в карциноме головы и шеи. корреляция экспрессии с биологическим поведением ORL J Оториноларингол Релат Спецификация7018

00810.1159 / 0001242

01196

24.

M YounesLV LechagoJR SomoanoM MosharafJ LechagoWide экспрессия переносчика глюкозы в эритроцитах человека Glut1 при раке человека Рак Res561164116719968640778

25.

S PizziA PorzionatoC PasqualiГлюкоза экспрессия транспортера-1 и прогностическое значение в поджелудочной железе. канцерогенез Гистол Гистопатол 241751852009134

26.

СемаанАР МункарахХ Араби Выражение GLUT-1 при эпителиальной карциноме яичников: корреляция с опухолевой клеткой пролиферация, ангиогенез, выживаемость и способность прогнозировать оптимальная циторедукция Oncol121181186201110.1016 / j.ygyno.2010.11.019

27.

HU VölkerM ScheichA Berndt Выражение p-AKT характеризует аденоидно-кистозные карциномы головы и шеи с более высокий риск рецидивов опухоли Диагностика 10

5368

28.

JY PaikBH KoKH JungKH Lee Фибронектин стимулирует поглощение 18F-FDG эндотелиальными клетками за счет фокальной адгезии киназа-опосредованная фосфатидилинозитол-3-киназа / передача сигналов Akt J Nucl Med50618624200910.2967 / номер.108.059386

29.

RL ElstromDE BauerM BuzzaiAkt стимулирует аэробный гликолиз в раковых клетках Res6438

10.1158 / 0008-5472.CAN-03-2

172999

30.

A BarthelST OkinoJ Liao Регулирование GLUT1 транскрипция гена серин / треонинкиназой Akt1J Biol Chem2742028120286199910.1074 / jbc.274.29.2028110400647

31.

JC RathmellCJ FoxDR PlasPS HammermanRM CinalliCB ThompsonAkt-направленный метаболизм глюкозы может предотвратить развитие Bax изменение экстерьера и независимость от фактора роста выживаниеMol Cell Биол2373157328200310.1128 / MCB.23.20.7315-7328.200314517300

32.

YK LeeJE KimSH Nam Дифференциальное регулирование биосинтеза переносчиков глюкозы PI3-K и MAPK пути передачи сигналов инсулина при лечении новыми соединениями из Liriope platyphyllaInt J Mol Med 2731

01121165549

33.

MA АлескандараньеEA RakhaMA AhmedDG PoweIO EllisAR Green Клиникопатологическое и молекулярное значение экспрессия фосфо-Akt при раннем инвазивном раке молочной железы Res Treat127407416201110.1007 / s10549-010-1012-y20617378

34.

JD CarptenAL FaberC HornA трансформер мутации в домене гомологии плекстрина AKT1 в ракПрирода448439444200710.1038 / природа05

611497

(PDF) Скрининг бластомеров рыбок данио идентифицирует подавление ретиноевой кислотой MYB при аденоидно-кистозной карциноме

Mandelbaum et al.

Ретиноиды подавляют

MYB

при аденоидно-кистозной карциноме

Журнал экспериментальной медицины

https://doi.org/10.1084/jem.20180939

2684

Иммуногистохимия была проведена Даннегистохимией.

Центр специализированной гистопатологии вардского онкологического центра.

Работа была поддержана поисковым фондом Adenoid Cystic Carcinoma Re-

search Foundation; Гарвардский институт стволовых клеток; Медицинский институт Ховарда

Хьюза; Национальные институты здравоохранения гранты

R01 HL048801, P01 HL032262, P30 DK049216, R01 DK053298,

U01 HL100001 и R24 DK0 L.И. Зон; награда

DFS-146184 Канадского института здравоохранения за докторскую степень за зарубежные исследования Дж. Мандельбауму; и Американское онкологическое общество

Постдокторантура 122577PF1214601DDC И.А. Шестопалов.

Л.И. Зон является основателем и держателем акций компаний Fate Therapeutics,

Scholar Rock и CAMP4 Therapeutics. Авторы не заявляют

о других конкурирующих финансовых интересах.

Автор: Л.И. Зон, Дж. Мандельбаум, И.А. Шес-

Топалов разработал исследование. Дж. Мандельбаум, И.А. Шестопалов, Р.

Хендерсон, Б. Кнучел и М.Дж. Вик провели эксперименты,

проанализировали данные и дали концептуальные советы. Л.И. Зон, Дж. Мандель —

,

баум и Н.Г. Рукопись написал Чау. Все авторы обсудили

результатов и рассмотрели рукопись.

Представлено: 21 мая 2018 г.

Исправлено: 16 июля 2018 г.

Принято: 23 августа 2018 г.

Источники

Allenby, G., М. Bocquel, M. Saunders, S. Kazmer, J. Speck, M. Rosenberger,

A. Lovey, P. Kastner, J.F. Grippo, P. Chambon, et al. 1993. Ретиноевая кислота

рецепторов и ретиноидных X рецепторов: взаимодействия с эндогенными ретиноевыми кислотами

. Proc. Natl. Акад. Sci. США. 90: 30–34. https: // doi .org / 10 .1073 /

pnas .90 .1 .30

Almeida, L.O., D.M. Гимарайнш, доктор медицины Мартинс, M.A.T. Мартинс, К. Warner,

J.E. Nör, R.M. Кастильо и Ч. Квадрат.2017. Разблокирование хрома

аденоидно-кистозных карцином с использованием ингибиторов HDAC повышает чувствительность стволовых клеток can-

cer к цисплатину и вызывает старение опухоли. Stem Cell Res.

(Амст.). 21: 94–105. https: // doi .org / 10 .1016 / j .scr .2017 .04 .003

Боббио, А., К. Копелли, Л. Амполлини, Б. Бьянки, П. Карбоньяни, С. Беттати, Э.

Сесенна и М. Руска. 2008. Резекция метастазов в легких аденоидной цис-

тиковой карциномы слюнных желез.Евро. J. Cardiothorac. Surg. 33: 790–793.

https: // doi .org / 10 .1016 / j .ejcts .2007 .12 .057

Boise, L.H., K.M. Горс, Э. Вестин. 1992. Множественные механизмы регуляции гена c-myb человека во время миеломоноцитарной дифференцировки.

Онкоген. 7: 1817–1825.

Брэдли, П.Дж. 2004. Аденоидно-кистозная карцинома головы и шеи: обзор.

Curr. Opin. Отоларингол. Head Neck Surg. 12: 127–132. https: // doi .org / 10

.1097 / 00020840-200404000 -00013

Brayer, K.J., C.A. Фрерих, Х. Канг и С.А. Несс. 2016. Рекуррентные слияния в

MYB и MYBL1 определяют общий, управляемый транскрипционным фактором ко-

когенный путь в аденоидной кистозной карциноме слюнных желез. Рак

Discov. 6: 176–187. https: // doi .org / 10 .1158 / 2159-8290 .CD -15-0859

Bruinsma, W., J.A. Raaijmakers и R.H. Medema. 2012. Включение и выключение Polo-like

kinase-1 во времени и пространстве.Trends Biochem. Sci. 37: 534–542.

https: // doi .org / 10 .1016 / j .tibs .2012 .09 .005

Coca-Pelaz, A., JP Rodrigo, PJ Bradley, V. Vander Poorten, A. Triantafyllou,

JL Хант, П. Строян, А. Ринальдо, М. Хайгенц-младший, Р.П. Тейкс и др. 2015.

Аденоидно-кистозный рак головы и шеи — Обновленная информация. Oral Oncol.

51: 652–661. https: // doi .org / 10 .1016 / j .oraloncology .2015 .04 .005

Cohen, D.E., and D. Melton. 2011 г.Превращение соломы в золото: определение судьбы клеток

для регенеративной медицины. Nat. Преподобный Жене. 12: 243–252. https: // doi .org /

10 .1038 / nrg2938

Conley, J., and D.L. Дингман. 1974. Аденоидно-кистозная карцинома головы

и

шеи (цилиндрома). Arch. Отоларингол. 100: 81–90. https: // doi .org / 10

.1001 / archotol .1974 .00780040087001

Cunningham, T.J., and G. Duester. 2015. Механизмы передачи сигнала ретиноевой кислоты —

и его роль в развитии органов и конечностей.Nat. Rev. Mol. Cell Biol.

16: 110–123. https: // doi .org / 10 .1038 / nrm3932

Das, B.C., P. Thapa, R. Karki, S. Das, S. Mahapatra, T.C. Лю, И. Торрегроза, Д.

Wallace, S. Kambhampati, P. Van Veldhuizen, et al. 2014. Ретиноевая кислота

Сигнальные пути

в развитии и заболеваниях. Биоорг. Med. Chem.

22: 673–683. https: // doi .org / 10 .1016 / j .bmc .2013 .11 .025

Degos, L., and Z.Y. Ван. 2001. Все транс-ретиноевой кислоты при остром промиело-

цитарном лейкозе.Онкоген. 20: 7140–7145. https: // doi .org / 10 .1038 / sj .onc

.1204763

Дриер, Ю., М.Дж. Коттон, К.Э. Уильямсон, С. Гиллеспи, Р.Дж. Райан, М.Дж. Клюк, К.Д.

Кэри, С.Дж. Родиг, Л.М.Шолль, А.Х. Афрохех и др. 2016. Онкогенная петля обратной связи

MYB управляет альтернативными клеточными судьбами в аденоидно-кистозном раке — номе

. Nat. Genet. 48: 265–272. https: // doi .org / 10 .1038 / ng .3502

Эллетт, Ф., Л. Пазе, Дж. У. Хейман, А. Андрианопулос и Г.J. Lieschke. 2011.

трансгенов промотора mpeg1 направляют экспрессию клонов макрофагов у

рыбок данио. Кровь. 117: e49 – e56. https: // doi.org / 10 .1182 / blood -2010-10

-314120

Evans, R.M., and D.J. Мангельсдорф. 2014. Ядерные рецепторы, RXR и большой взрыв

. Клетка. 157: 255–266. https: // doi .org / 10 .1016 / j .cell .2014 .03 .012

Ферраротто, Р., Я. Митани, Л. Диао, И. Гихарро, Дж. Ван, П. Цвейдлер-Маккей, Д.

Белл, В.Н. Уильям-младший, Б.С. Глиссон, М.Дж. Вик и др. 2017. Активация мутаций NOT

Ch2 определяет отдельную подгруппу пациентов с аденоидом

Кистозная карцинома с плохим прогнозом, предрасположенностью к костям и

метастазами в печени и потенциальной реактивностью на ингибиторы Notch2. J.

Clin. Онкол. 35: 352–360. https: // doi .org / 10 .1200 / JCO .2016 .67 .5264

Graf, T. 1992. Myb: активатор транскрипции, связывающий пролиферацию и диференцию

в гемопоэтических клетках.Curr. Opin. Genet. Dev. 2: 249–255.

https: // doi .org / 10 .1016 / S0959 -437X (05) 80281-3

Hall, C., M.V. Флорес, Т. Сторм, К. Крозье и П. Крозье. 2007. Промотор лизоцима С рыбок данио

управляет миелоид-специфической экспрессией у трансгенных рыб

. BMC Dev. Биол. 7:42. https: // doi .org / 10 .1186 / 1471 -213X -7-42

Hickman, R.E., R.A. Коусон и С. Даффи. 1984. Прогноз

конкретных

типов опухолей слюнных желез.Рак. 54: 1620–1624. https: // doi .org / 10

.1002 / 1097-0142 (19841015) 54: 8% 3C1620 :: AID -CNCR2820540824% 3E3

.0 .CO; 2 -I

Hnisz, D., BJ Авраам, Т. Ли, А. Лау, В. Сен-Андре, А.А. Сигова, Х.А.

Хок, Р.А. Молодой. 2013. Супер-энхансеры в контроле идентичности и болезни клеток

. Клетка. 155: 934–947. https: // doi .org / 10 .1016 / j .cell

.2013 .09 .053

Ho, A.S., K. Kannan, D.M. Рой, Л. Моррис, И.Ganly, N. Katabi, D. Ramaswami,

L.A. Walsh, S. Eng, J.T. Huse и др. 2013. Мутационный ландшафт

аденоидно-кистозной карциномы. Nat. Genet. 45: 791–798. https: // doi .org / 10

.1038 / ng .2643

Langmead, B., and S.L. Зальцберг. 2012. Быстрое выравнивание с пропуском чтения с галстуком Bow-

2. Нат. Методы. 9: 357–359. https: // doi .org / 10 .1038 / nmeth .1923

Lee, T.I., S.E. Джонстон, Р.А. Молодой. 2006. Иммунопреципитация хроматина

и анализ локализации белков на основе микрочипов.Nat. Protoc.

1: 729–748. https: // doi .org / 10 .1038 / nprot .2006 .98

Li, P., J.L. Lahvic, V. Binder, E.K. Пугач, Э. Райли, О. Тамплин, Д. Паниграхи,

T.V. Bowman, F.G. Барретт, Г. Хеффнер и др. 2015. Эпоксиэйкозатриеновая

кислоты усиливают эмбриональный гематопоэз и приживление костного мозга у взрослых —

. Природа. 523: 468–471. https: // doi .org / 10 .1038 / nature14569

Lo-Coco, F., L. Di Donato, R.F. Schlenk, GIM EMA и Немецко-австрийская группа по изучению острого лейкоза

, Группа по изучению миелоидной лейкемии и Альянс по изучению лейкемии.2016.

Таргетная терапия только для острого промиелоцитарного лейкоза. N. Engl. J.

Med. 374: 1197–1198. https: // doi .org / 10 .1056 / NEJMc1513710

Lutz, P.G., A. Houzel-Charavel, C. Moog-Lutz и Y.E. Cayre. 2001. Myeloblas-

олово является геном-мишенью Myb: механизмы регуляции миелоидных клеток leuke-

mia, рост которых задерживается ретиноевой кислотой. Кровь. 97: 2449–2456. https: //

doi .org / 10 .1182 / blood .V97 .8 .2449

Mathelier, A., О. Форнес, Д.Дж. Аренильяс, С. Chen, G. Denay, J. Lee, W. Shi, C.

Shyr, G. Tan, R. Worsley-Hunt и др. 2016. JAS PAR 2016: значительное расширение —

и обновление базы данных открытого доступа профилей связывания факторов транскрипции

. Nucleic Acids Res. 44 (D1): D110 – D115. https: // doi .org / 10

.1093 / nar / gkv1176

McKeown, M.R., M.R. Corces, M.L. Eaton, C. Fiore, E. Lee, J.T. Lopez, M.W.

Chen, D. Smith, S.M. Чан, Дж. Л. Кениг и др.2017. Superenhancer Anal-

ysis определяет новые эпигеномные подтипы не-APL AML, включая зависимость

RARα, на которую нацелен SY-1425, мощный и селективный агонист RARα

. Рак Discov. 7: 1136–1153. https: // doi .org / 10 .1158 / 2159-8290

.CD -17-0399

Mikse, O.R., J.H. Чайча, Э.А. Акбай, Л. Чен, Р. Бронсон, П. Хаммер-

человек, К.К. Вонг. 2016. Влияние слияния MYB-NFIB pro-

на онкоген in vivo.Oncotarget. 7: 31681–31688. https: // doi .org / 10

.18632 / oncotarget .9426

Mitani, Y., B. Liu, P.H. Рао, В.Дж. Борра, М. Заферео, Р.С. Weber, M. Kies, G.

Lozano, P.A. Футреал, К. Коллин, А.К. Эль-Наггар. 2016. Роман MYBL1

NEI Projects

Содержимое

Глиобластома (ГБМ), наиболее распространенная и агрессивная первичная опухоль у взрослых, поражает примерно 15000 человек ежегодно, а среднее время выживания составляет всего 14.6 месяцев. Текущее стандартное лечение ГБМ состоит из комбинации хирургического вмешательства и радиохимиотерапии. Инфильтрирующие свойства GBM и возникающий в результате посев отдаленных опухолевых клеток часто делают недостаточным только хирургическую резекцию, в то время как только лучевая терапия также ограничена из-за присущей клеткам GBM радиорезистентности.

При химиотерапии основной причиной неудач является плохая доставка терапевтических агентов через гематоэнцефалический барьер (ГЭБ). Это требует использования высоких концентраций лекарств в плазме, что подвергает пациентов частым и серьезным побочным эффектам.Чтобы обойти ГЭБ, врачи часто выбирают прямую внутриопухолевую инъекцию химиотерапевтических агентов, что часто приводит к обратному потоку, утечке и отсутствию начального распределения терапевтического агента. По этой причине предпринимаются постоянные усилия по совершенствованию существующих методов лечения и разработке новых методов лечения.

MCB-613 может оказаться эффективным средством лечения ГБМ. Это мощный низкомолекулярный стимулятор SRC (коактиватор стероидных рецепторов), который, как было показано, стимулирует SRC-1, SRC-2 и SRC-3, которые используются для нарушения гомеостатической зависимости раковых клеток от SRC.Кроме того, доказано, что MCB-613 высококонцентрирован в паренхиме мозга из-за его липофильных свойств, что означает, что он свободно проникает через ГЭБ. В предварительных исследованиях in vitro было показано, что MCB-613 и его производные снижают жизнеспособность большинства линий раковых клеток, особенно U87. В большинстве клеточных линий ЕС50 составляет примерно 5-6 микромоль, тогда как в клетках U87 она составляет 3 микромоля, что указывает на то, что клетки U87 довольно чувствительны к MCB-613 и его производным.

В этом сотрудничестве с Dr.Лаборатория Берта О’Мэлли в BCM и лаборатория доктора Фредрика Лэнга в MD Anderson, мы надеемся показать эффективность MCB-613, и, учитывая эффективность в исследованиях in vitro, это было бы идеальным лечением GBM и других раковых клеток. линий.

Нокдаун гистон-метилтрансферазы WHSC1 индуцирует апоптоз и ингибирует пролиферацию клеток и опухолеобразование при аденоидной кистозной карциноме слюнной железы

Abstract

Предпосылки / цель: Аденоидно-кистозная карцинома слюнной железы (SACC) является наиболее частым злокачественным новообразованием слюнной железы и предрасположенностью к выживанию. .Настоящее исследование направлено на изучение роли гистон-метилтрансферазы WHSC1 в SACC. Материалы и методы. Образцы SACC человека оценивали на экспрессию WHSC1 с помощью ОТ-ПЦР и иммуногистохимии. Были исследованы эффекты нокдауна WHSC1 на пролиферацию клеток SACC, клеточный цикл, образование клонов и опухолевых сфер и апоптоз, а также на экспрессию родственных генов. Модель SACC на мышах с ксенотрансплантатом использовали для оценки in vivo эффектов нокдауна WHSC1 на онкогенез SACC.Результаты: экспрессия WHSC1 повышалась в тканях SACC человека (p <0,01). Нокдаун WHSC1 в клетках SACC значительно ингибировал пролиферацию клеток, образование клонов и опухолевых сфер (p <0,05). Распределение клеток в фазах S и G 2 / M было значительно снижено при нокдауне WHSC1 (p <0,05). Нокдаун WHSC1 значительно увеличивал апоптоз клеток SACC (p <0,05). Гены c-Myc, сурвивина, Bcl-2 и циклина B1 значительно подавлялись нокдаун-клетками WHSC1 (p <0,05).Нокдаун WHSC1 значительно снижал модификацию h4K36me2 промотора гена MYC в клетках SACC и онкогенез клеток SACC in vivo (p <0,05). Заключение: нокдаун WHSC1 ингибировал пролиферацию клеток, индуцировал апоптоз и влиял на онкогенез в SACC.

Аденоидно-кистозная карцинома слюнной железы (SACC) возникает из секреторных эпителиальных клеток слюнных желез (1) и является наиболее частым злокачественным новообразованием слюнных желез, на которое приходится около 25-50% злокачественных опухолей большой или малой слюнной железы. железы соответственно (2-4).SACC демонстрирует уникальные характеристики, которые приводят к плохому прогнозу и низкой общей выживаемости (5). Недавние открытия молекулярной патологии предполагают, что генетическая транслокация и / или сверхэкспрессия онкопротеинов важны для онкогенеза и диагностики слюнных желез. Исследования показали, что повторяющееся слияние генов MYB-NFIB является основным геномным признаком SACC (6, 7). Однако необходимы дальнейшие молекулярно-генетические исследования для выявления биомаркеров, а также терапевтических мишеней или прогностических факторов ACC.

Модификация метилирования гистонов — важный процесс, участвующий в регуляции экспрессии онкогенных генов и контролируемый гистоновыми метилтрансферазами и деметилазами. WHSC1 (также известная как NSD2) представляет собой гистоновую метилтрансферазу, которая опосредует диметилирование гистона 3 лизина 36 (h4K36me2). Было обнаружено, что метилирование h4K36 связано с активацией транскрипции при многих видах рака 8). Повышенная экспрессия WHSC1 была обнаружена во многих солидных опухолях, таких как множественная миелома, рак простаты, рак груди и рак головы и шеи (8-10). Исследования in vitro показали, что WHSC1 модулирует Ras-связанные Транскрипция субстрата 1 ботулинического токсина C3 (Rac1), фактора транскрипции 1 семейства твистов (TWIST1) и ядерного фактора κB (NF-κB), способствующих онкогенезу и метастазированию (11, 12). Однако роль WHSC1 в SACC остается неясной.

Таблица I.

Праймеры, используемые для количественной ПЦР в реальном времени.

Таблица II.

Праймеры, используемые для анализа ChIP-qPCR.

В настоящем исследовании было обнаружено, что WHSC1 активируется в SACC человека.Были исследованы эффекты нокдауна WHSC1 в клетках SACC на пролиферацию, апоптоз и туморогенез.

Материалы и методы

Пациенты и образцы. В общей сложности 23 аденоидно-кистозных карциномы слюнных желез и 23 совпадающих образца паракарциномы нормальной слюнной железы были получены от пациентов, перенесших операцию в период с 2002 по 2014 год в больнице провинции Шаньдун при Шаньдунском университете. Диагноз подтвержден гистологически опытными патологами.Исследование было одобрено Комитетом по этике исследований дочерней больницы провинции Шаньдун Университета Шаньдун (номер одобрения: 2018-230), и от всех пациентов было получено письменное информированное согласие.

Иммуногистохимия (ИГХ). ИГХ проводили на фиксированных формалином и залитых парафином предметных стеклах толщиной 5 мкм. После депарафинизации, регидратации, поиска антигена и эндогенной блокады пероксидазы. Затем образцы инкубировали со следующими антителами: анти-WHSC1 (ab75359, Abcam, Кембридж, Великобритания), анти-расщепленная каспаза-3 (9661, Cell Signaling Technology, Бостон, США), анти-Ki67 (GB13030-2, Servicebio, Ухань, П.Р. Китай) при 4 ° С в течение 8-10 ч. Затем срезы инкубировали со вторичным антителом (7074, Cell Signaling Technology, Бостон, Массачусетс, США) в течение 30 минут при комнатной температуре. Проявление цвета выполняли с помощью 3’-диаминобензидина (DAB) (K5007, DAKO, Копенгаген, Дания). Ядра слегка окрашивали гематоксилином. Срезы просматривали с помощью микроскопа (DM 4000B, Leica, Wetzlar, Германия), и положительные клетки распознавали по появлению коричневого окрашивания. Уровни экспрессии оценивали по индексам окрашивания с использованием метода количественной оценки по 10 точкам (13).Баллы от 0 до 5 указывают на низкую экспрессию, а баллы от 6 до 10 — на высокую.

Культура клеток. Клеточные линии аденоидной кистозной карциномы слюнной железы человека SACC-83 и SACC-LM были приобретены из Американской коллекции типовых культур. Клетки выращивали в среде DMEM (Hyclone, UT, США) с 10% FBS (Gibco, Калифорния, США) и антибиотиками (пенициллин 100 Ед / мл, стрептомицин 100 мкг / мл) при 37 ° C в увлажненной атмосфере с 5% CO. 2 .

трансфекция shРНК. Две WHSC1-специфичные короткие шпилечные РНК (WHSC1-KD1 и WHSC1-KD2 shRNA) были сконструированы и клонированы в плазмиду pLVX-shRNA1.Последовательность бессмысленного скремблирования использовалась в качестве отрицательного контроля. Плазмиды были упакованы в лентивирус с использованием системы из трех плазмид, pLVX-shRNA1 с целевой последовательностью, psPAX2 и pMD2G. Клетки SACC-83 и SACC-LM трансфицировали и проверяли пуромицином 2 мг / мл в течение 2 недель. Последовательность shRNA WHSC1-KD1 была TGCCAATAACACGTCCACT, а последовательность shRNA WHSC1-KD2 была CCCTTCGCAGTGTTTGTCT.

Рисунок 1.

Повышающая регуляция гистон-метилтрансферазы WHSC1 в SACC человека. (A) Повышающая регуляция WHSC1 была обнаружена в когорте GSE59701.(B) Уровни мРНК WHSC1 в опухоли и соответствовали нормальным тканям (парный t-критерий). (C и D) Иммуногистохимическое определение экспрессии WHSC1 в образцах SACC и нормальных слюнных железах. * p <0,01 по сравнению с нормальными тканями.

Анализ пролиферации клеток. Пролиферацию клеток измеряли с помощью анализа CCK8. Клетки (5 × 10 3 ) переносили в 96-луночный планшет в RPMI 1640, содержащем 10% FBS. Через 24, 48 и 72 часа инкубации в каждую лунку на 2 часа добавляли реагент CCK8 (разведение 1:10).Оптическую плотность (OD) при длине волны 450 нм определяли с помощью ридера для микропланшетов (Bio-Rad, Калифорния, США). Кривые пролиферации строили для каждой из групп клеток.

Анализ эффективности клонирования. . 1000 клеток добавляли в каждую лунку 6-луночного планшета, полученные колонии фиксировали, окрашивали 0,1% кристаллическим фиолетовым на 7 день и подсчитывали количество колоний.

Образование опухолевой сферы. Суспензии единичных клеток добавляли в планшеты со сверхнизким прикреплением в определенной среде при плотности 1000 клеток / лунку.Определенная бессывороточная среда содержала DMEM / F-12 с добавкой B27 (1:50), EGF (20 нг / мл) и FGF (10 нг / мл). Через семь дней после непрерывного культивирования количество сфер регистрировали под микроскопом. Через день добавляли половину объема среды. Изображения были получены на 7-й день с помощью инвертированного микроскопа, количественно оценивались только сферы размером более 100 мкм.

Анализ апоптоза. Процент клеток, подвергающихся апоптозу, оценивали с помощью проточной цитометрии (Beckman Gallios, Brea, CA, USA).После инкубации с цисплатином в течение 48 часов клетки собирали, промывали и ресуспендировали в 100 мкл буфера для окрашивания с добавлением 1 мкл 7-AAD (559925, BD Biosciences, Нью-Джерси, США) и 5 ​​мкл Annexin-V-APC (556421, BD Biosciences). ).

Анализ клеточного цикла. Анализ 5-этинил-2 дезоксиуридина (EdU) выполняли в соответствии с инструкциями производителя (C0071L, Beyotime, Шанхай, Китай), клетки SACC-83 и SACC-LM инкубировали с EdU в течение 2 часов.

Экстракция РНК и количественная ПЦР в реальном времени. Тотальную РНК выделяли из клеток с использованием TRIzol Reagent (15596-018, Invitrogen, Carlsbad, CA, USA). 1 мкг тотальной РНК подвергали обратной транскрипции с использованием набора TaKaRa RT-PCR (Takara, Shiga, Japan) в соответствии с инструкциями производителя. с последующей амплификацией ПЦР со специфическими праймерами (таблица I). Данные были проанализированы методом относительной стандартной кривой и нормализованы к экспрессии GAPDH . Относительную экспрессию РНК в клетках рассчитывали с использованием метода 2 — ΔΔCt .

Вестерн-блоттинг. Белковые экстракты клеток получали с буфером RIPA (Roche Diagnostics, Indianapolis, IN, USA). 30 мкг белкового лизата разделяли с помощью гель-электрофореза в 10% SDS – PAGE и электрофоретически переносили на мембрану из поливинилиденфторида (PVDF) (Millipore, Bedford, MA, USA). Мембраны инкубировали с 10% обезжиренным молочным раствором для блокирования неспецифического связывания, а затем с анти-c-Myc (9402, Cell Signaling Technology, Бостон, Массачусетс, США), анти-WHSC1 (ab75359, Abcam, Кембридж, Великобритания). , анти-Bcl-2 (4223S, Cell Signaling Technology), антициклин B1 (4138, Cell Signaling Technology), антитела против сурвивина (2808, Cell Signaling Technology) или антитела против GAPDH (5174S, Cell Signaling Technology).После двукратной промывки физиологическим раствором с трис-буфером мембраны инкубировали с соответствующими вторичными антителами, конъюгированными с HRP, в течение 2 часов при комнатной температуре. Анализ электрохемилюминесценции выполняли в соответствии с инструкциями производителя (WBKLS0050, Millipore).

Рисунок 2. Нокдаун

WHSC1 подавляет рост клеток SACC и раковых стволовых клеток. (A и B) Рост in vitro контрольных клеток и клеток WHSC1-KD, SACC-83 и SACC-LM по оценке с помощью анализа CCK-8. (C и D) Анализ образования клонов в контрольных клетках и клетках WHSC1-KD.(E и F) Формирование опухолевой сферы контрольных и WHSC1-KD, SSACC-83 и HSACC клеток, * p <0,05 по сравнению с контролем.

Исследование in vivo. BALB / C голых мышей в возрасте 4-6 недель и массой 20-25 г были приобретены в SHANGHAI SLAC (Шанхай, Китай). Всех мышей содержали в среде с фильтром HEPA при 24-25 ° C и влажности 50-60%. Все эксперименты на животных были одобрены Комитетом по уходу и использованию животных в учреждениях и проводились в соответствии с Руководством NIH.

Рисунок 3.

Эффект нокдауна WHSC1 на клеточный цикл и апоптоз. (A и B) Контрольные клетки и клетки WHSC1-KD, SACC-83 и SACC-LM инкубировали с 5-этинил-2 дезоксиуридином (EdU) в течение двух часов и окрашивали антителом против EDU и 7AAD. (C и D) Клетки окрашивали аннексином V и 7AAD и анализировали проточной цитометрией. * р <0,05 по сравнению с контролем.

Ксенотрансплантатные мышиные модели аденоидной кистозной карциномы слюны были созданы путем подкожной инъекции 1 × 10 6 трансфицированных клеток SACC в бок голых мышей.Рост опухоли измеряли еженедельно штангенциркулем. Объем опухоли рассчитывали по формуле (L × W 2 ) × ½, где W и L представляют перпендикулярные малый и большой размер, соответственно. Всех животных умерщвляли через 21 день после имплантации опухолевых клеток. При вскрытии опухоль удалили и взвесили.

Анализ ChIP-qPCR. 2 × 10 7 Клетки SACC-83 и WHSC1-нокдаун SACC-83 сшивали, лизировали и разрезали до примерно 200-700 пар оснований ДНК с использованием UCD-300 (Bioruptor, BE).ChIP выполняли с использованием набора Magnetic ChIP в соответствии с инструкциями производителя (17-371, Millipore). Затем проводили количественную оценку ДНК, обогащенной ChIP, с помощью qPCR. Используемые ChIP-антитела были анти-h4K36me2 (61019, Active Motif, CA, USA) и нормальным кроличьим IgG. Используемые праймеры перечислены в таблице II.

Статистический анализ. Все эксперименты были повторены не менее трех раз, как указано. Данные выражены как среднее ± стандартное отклонение. Все статистические анализы были выполнены с использованием SPSS16.0 (SPSS inc., Чикаго, Иллинойс, США). Сравнение данных между двумя группами проводилось с использованием теста Стьюдента t . Статистически значимым считалось значение p <0,05.

Результаты

Экспрессия WHSC1 повышается в SACC человека. Для оценки экспрессии WHSC1 в образцах SACC человека были получены наборы данных GSE59701 с веб-сайта GEO, и был записан список экспрессии 20 201 гена из 12 образцов SACC с соответствующими нормальными тканями.Экспрессия мРНК WHSC1 была значительно выше в тканях SACC по сравнению с парными нормальными контролями ( p <0,01) (рис. 1A). Экспрессия WHSC1 была дополнительно исследована на образцах SACC. Анализ RT-qPCR показал, что экспрессия мРНК WHSC1 также была значительно выше в биоптатах 23 пациентов с SACC по сравнению с образцами их нормальной слюнной железы с паракарциномой ( p <0,01) (Рисунок 1B). Иммуногистохимический анализ также выявил значительно более высокую экспрессию WHSC1 в биоптатах 23 пациентов с SACC по сравнению с их паракарциномы нормальные образцы слюнной железы ( p <0.05) (Рисунок 1C и D).

Рисунок 4.

WHSC1 регулирует гены, связанные с апоптозом и стволовостью клеток, опосредуя модификацию h4K36me2. (A) RT-qPCR генов, связанных со стволовостью, ростом опухоли и апоптозом, в контрольных клетках и клетках WHSC1-KD SACC-83. (B) Вестерн-блоттинг указанных белков в контроле и клетках WHSC1-KD SACC-83. GAPDH служил контролем загрузки. (C) ChIP-qPCR анализ обогащения h4K36me2 промотором гена MYC в контрольных клетках и клетках WHSC1-KD SACC-83. * p <0,05 по сравнению с контролем.

Нокдаун WHSC1 подавляет рост клеток SACC и раковых стволовых клеток. Нокдаун WHSC1 в клетках SACC-83 и SACC-LM выполняли путем трансфекции их WHSC1-специфической короткой шпилечной РНК. Эффект нокдауна WHSC1 на рост клеток оценивали путем изучения пролиферации клеток, а также образования клонов и опухолевых сфер. Клетки SACC-83 и SACC-LM, трансфицированные WHSC1-KD1 или WHSC1-KD2, показали значительно сниженную пролиферацию клеток по сравнению с контрольными клетками SACC-83 и SACC-LM ( p <0.05) (Рисунок 2A и B). Образование клонов было значительно ингибировано в клетках SACC-83 и SACC-LM, трансфицированных WHSC1-KD1 или WHSC1-KD2, по сравнению с контролем клеток SACC-83 и SACC-LM ( p <0,05) (рис. 2C и 2D).

Раковые стволовые клетки (РСК) тесно коррелируют с онкогенезом многих солидных опухолей (14, 15). Интересно, что нокдаун WHSC1 заметно снижает способность клеток SACC образовывать сферы опухоли (рис. 2E и F), предполагая, что WHSC1 может влиять на свойства раковых стволовых клеток в SACC.

Влияние нокдауна WHSC1 на клеточный цикл. Эффект нокдауна WHSC1 на клеточный цикл оценивали с помощью анализа Edu. Как показано на фиг. 3A и B, распределение клеток в фазах S и G 2 / M было значительно снижено в клетках SACC-83 и SACC-LM, трансфицированных WHSC1-KD1 или WHSC1-KD2, по сравнению с SACC-83 и SACC- LM клеточный контроль ( p <0,05).

WHSC1 регулирует гены, связанные с апоптозом и стволовостью клеток. Эффекты нокдауна WHSC1 на апоптоз клеток оценивали с помощью анализа аннексина V-7AAD.WHSC1 нокдаун в клетках SACC-83 и SACC-LM значительно увеличивал апоптоз клеток по сравнению с контролем клеток SACC-83 и SACC-LM ( p <0,05) (рис. 3C и D).

Рисунок 5. Нокдаун

WHSC1 ингибирует прогрессирование SACC in vivo. (A) Макроскопическое изображение размера опухоли (верхняя панель) и гистограмма, показывающая изменение объема в указанные моменты времени и вес опухоли на 21 день, когда мышей умерщвляли. (B) Размер опухоли оценивали в указанные дни, объем опухоли рассчитывали по формуле V = 0.5 * a * b * b (a — длинный диаметр, b — короткий). (C) Вес опухоли измеряли, когда мышей умерщвляли на 21 день. (D) ИГХ-окрашивание расщепленной каспазы 3 и Ki67 в репрезентативных опухолевых тканях контрольной группы и группы WHSC1-KD. * p <0,05 по сравнению с контролем.

c-Myc, фактор, связанный с дифференцировкой стволовых клеток опухоли, заметно подавлялся в клетках SACC-83 и SACC-LM, трансфицированных WHSC1-KD1 или WHSC1-KD2, по сравнению с контролем ( p <0.05) (Рисунок 4A и B). Сурвивин и Bcl-2, два антиапоптотических фактора (16, 17), значительно ингибировались в клетках SACC-83 и SACC-LM, трансфицированных WHSC1-KD1 или WHSC1-KD2, по сравнению с контролем ( p <0,05) (Рисунок 4B). Кроме того, циклин B1, который связан с контрольной точкой G 2 / M (18), также был снижен в клетках SACC-83 и SACC-LM, трансфицированных WHSC1-KD1 или WHSC1-KD2, по сравнению с контролем ( p <0,05) (рис. 4В). Эти результаты показывают, что нокдаун WHSC1 подавляет экспрессию апоптотических и связанных со стволовостью генов в клетках SACC.

WHSC1 опосредует модификацию h4K36me2 в локусах MYC. WHSC1 представляет собой гистон-метилтрансферазу h4K36me2. Метилирование h4K36 способствует транскрипции гена. Анализ ChIP-qPCR продемонстрировал, что нокдаун WHSC1 снижает модификацию h4K36me2 в промоторе гена MYC (рис. 4C). Эти данные показали, что истощение WHSC1 может приводить к более конденсированному хроматину в локусе гена MYC и тем самым ингибировать транскрипцию c-Myc в клетках SACC. Следовательно, WHSC1 может напрямую регулировать экспрессию c-Myc, опосредуя модификацию h4K36me2.

Нокдаун WHSC1 ингибирует онкогенез SACC in vivo. Эффекты нокдауна WHSC1 на онкогенез оценивали на мышиной модели SACC. Животные с опухолью, полученной из клеток SACC-83 и SACC-LM, трансфицированных WHSC1-KD1 или WHSC1-KD2, показали значительно меньшие размер и вес опухоли по сравнению с контролем ( p <0,05) (фиг. 5A- C). Количество расщепленных положительных по каспазе 3 клеток было значительно увеличено в клетках SACC-83 и SACC-LM, трансфицированных WHSC1-KD1 или WHSC1-KD2, по сравнению с контролем ( p <0.05). Однако экспрессия Ki67 была сходной во всех группах (рис. 5D). Эти результаты демонстрируют, что нокдаун WHSC1 подавляет онкогенез и усиливает апоптоз in vivo .

Обсуждение

В настоящем исследовании было обнаружено, что WHSC1 активируется в SACC человека, а активация WHSC1 ингибирует апоптоз клеточной линии SACC как in vitro, , так и in vivo . WHSC1 регулирует транскрипцию ключевых внутриклеточных сигнальных молекул, включая BCL-2 и SOX2, опосредуя их модификацию h4K36me2.

В этом отчете показано, что высокие уровни WHSC1 в клетках SACC способствовали пролиферации и ингибировали апоптоз посредством эпигенетического репрограммирования подмножества генов, что указывает на ген MYC . Нокдаун WHSC1 значительно снижает модификации h4K36me2 в промоторной области MYC, что, вероятно, приводит к более конденсированному хроматину и снижению транскрипции MYC.

Наши результаты подтверждают тесную взаимосвязь между эпигенетическим регулятором WHSC1 и ключевыми внутриклеточными факторами и молекулами транскрипции.MYC является ключевым геном, связанным со стволовостью, и онкогенным драйвером, который способствует злокачественной трансформации многих опухолей (19, 20). Нокдаун WHSC1 значительно снижает уровень модификации h4K36me2 в локусе гена MYC, что приводит к ингибированию транскрипции этого ключевого онкогена.

В заключение, экспрессия WHSC1 была повышена у пациентов с SACC человека. Нокдаун WHSC1 в клеточных линиях SACC был связан со снижением пролиферации клеток, усилением апоптоза и снижением туморогенеза. WHSC1 может быть потенциальной мишенью для эффективной терапии SACC.

Благодарности

Настоящее исследование финансируется грантами Национального фонда естественных наук Китая (№№ 81771087 и 81470755) и Шаньдунского провинциального фонда естественных наук, Китай (№ ZR2017BH005).

Сноски

  • ↵ * Эти авторы внесли равный вклад в это исследование.

  • Вклад авторов

    CHAO LIU и JIA-WEI ZHENG разработали исследование, проанализировали данные, подготовили рисунки и написали черновик рукописи; CHAO LIU и ZE-LIANG ZHAO провели исследование in vitro ; HAI-WEI WU и LING ZHANG провели исследование in vivo ; ЧЖИЦЗЯН ЯН и РОБЕРТ М.ХОФФМАН руководил исследованием и отредактировал рукопись.

  • Эта статья находится в свободном доступе в Интернете.

Добавить комментарий

Ваш адрес email не будет опубликован.

© 2022 ООО Агентство Лидер